ID: 948365295

View in Genome Browser
Species Human (GRCh38)
Location 2:237450779-237450801
Sequence GGGCACGGACCTCCCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365285_948365295 21 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365295 2:237450779-237450801 GGGCACGGACCTCCCCACCCTGG No data
948365281_948365295 26 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365295 2:237450779-237450801 GGGCACGGACCTCCCCACCCTGG No data
948365282_948365295 25 Left 948365282 2:237450731-237450753 CCGGCCTGGCACACAAGCTGCAT No data
Right 948365295 2:237450779-237450801 GGGCACGGACCTCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365295 Original CRISPR GGGCACGGACCTCCCCACCC TGG Intergenic