ID: 948365297

View in Genome Browser
Species Human (GRCh38)
Location 2:237450787-237450809
Sequence ACCTCCCCACCCTGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365292_948365297 -4 Left 948365292 2:237450768-237450790 CCCAGCCAGGTGGGCACGGACCT No data
Right 948365297 2:237450787-237450809 ACCTCCCCACCCTGGGTCTCAGG No data
948365285_948365297 29 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365297 2:237450787-237450809 ACCTCCCCACCCTGGGTCTCAGG No data
948365293_948365297 -5 Left 948365293 2:237450769-237450791 CCAGCCAGGTGGGCACGGACCTC No data
Right 948365297 2:237450787-237450809 ACCTCCCCACCCTGGGTCTCAGG No data
948365294_948365297 -9 Left 948365294 2:237450773-237450795 CCAGGTGGGCACGGACCTCCCCA No data
Right 948365297 2:237450787-237450809 ACCTCCCCACCCTGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365297 Original CRISPR ACCTCCCCACCCTGGGTCTC AGG Intergenic