ID: 948369035

View in Genome Browser
Species Human (GRCh38)
Location 2:237475625-237475647
Sequence CTCGGGGCCCCGCCGGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948369035_948369045 -1 Left 948369035 2:237475625-237475647 CCCGAAGCCGGCGGGGCCCCGAG No data
Right 948369045 2:237475647-237475669 GGGGGTCCGCGCTGCCTGCCCGG No data
948369035_948369053 23 Left 948369035 2:237475625-237475647 CCCGAAGCCGGCGGGGCCCCGAG No data
Right 948369053 2:237475671-237475693 GACCCCTTTTCTTGGCAGAGAGG No data
948369035_948369050 15 Left 948369035 2:237475625-237475647 CCCGAAGCCGGCGGGGCCCCGAG No data
Right 948369050 2:237475663-237475685 TGCCCGGGGACCCCTTTTCTTGG No data
948369035_948369046 0 Left 948369035 2:237475625-237475647 CCCGAAGCCGGCGGGGCCCCGAG No data
Right 948369046 2:237475648-237475670 GGGGTCCGCGCTGCCTGCCCGGG No data
948369035_948369047 1 Left 948369035 2:237475625-237475647 CCCGAAGCCGGCGGGGCCCCGAG No data
Right 948369047 2:237475649-237475671 GGGTCCGCGCTGCCTGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948369035 Original CRISPR CTCGGGGCCCCGCCGGCTTC GGG (reversed) Intergenic
No off target data available for this crispr