ID: 948370072

View in Genome Browser
Species Human (GRCh38)
Location 2:237483283-237483305
Sequence GGTCAGGCAAGTCCCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948370072_948370081 7 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370072_948370082 22 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370082 2:237483328-237483350 TGCCCAGGCAGTGAAATTAAAGG No data
948370072_948370077 -4 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370072_948370076 -5 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370076 2:237483301-237483323 TGACCAGTTATCCTTGGAACTGG No data
948370072_948370083 23 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370072_948370078 -3 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370078 2:237483303-237483325 ACCAGTTATCCTTGGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948370072 Original CRISPR GGTCAGGCAAGTCCCACTGA GGG (reversed) Intergenic