ID: 948370077

View in Genome Browser
Species Human (GRCh38)
Location 2:237483302-237483324
Sequence GACCAGTTATCCTTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948370071_948370077 -3 Left 948370071 2:237483282-237483304 CCCCTCAGTGGGACTTGCCTGAC No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370069_948370077 6 Left 948370069 2:237483273-237483295 CCAAGGCCACCCCTCAGTGGGAC No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370070_948370077 0 Left 948370070 2:237483279-237483301 CCACCCCTCAGTGGGACTTGCCT No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370068_948370077 7 Left 948370068 2:237483272-237483294 CCCAAGGCCACCCCTCAGTGGGA No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370064_948370077 30 Left 948370064 2:237483249-237483271 CCACGTGCAGAGAGGAGGCTAAG No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370072_948370077 -4 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data
948370073_948370077 -5 Left 948370073 2:237483284-237483306 CCTCAGTGGGACTTGCCTGACCA No data
Right 948370077 2:237483302-237483324 GACCAGTTATCCTTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948370077 Original CRISPR GACCAGTTATCCTTGGAACT GGG Intergenic