ID: 948370081

View in Genome Browser
Species Human (GRCh38)
Location 2:237483313-237483335
Sequence CTTGGAACTGGGGTATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948370068_948370081 18 Left 948370068 2:237483272-237483294 CCCAAGGCCACCCCTCAGTGGGA No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370069_948370081 17 Left 948370069 2:237483273-237483295 CCAAGGCCACCCCTCAGTGGGAC No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370072_948370081 7 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370075_948370081 -9 Left 948370075 2:237483299-237483321 CCTGACCAGTTATCCTTGGAACT No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370073_948370081 6 Left 948370073 2:237483284-237483306 CCTCAGTGGGACTTGCCTGACCA No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370070_948370081 11 Left 948370070 2:237483279-237483301 CCACCCCTCAGTGGGACTTGCCT No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data
948370071_948370081 8 Left 948370071 2:237483282-237483304 CCCCTCAGTGGGACTTGCCTGAC No data
Right 948370081 2:237483313-237483335 CTTGGAACTGGGGTATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948370081 Original CRISPR CTTGGAACTGGGGTATGCCC AGG Intergenic