ID: 948370083

View in Genome Browser
Species Human (GRCh38)
Location 2:237483329-237483351
Sequence GCCCAGGCAGTGAAATTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948370073_948370083 22 Left 948370073 2:237483284-237483306 CCTCAGTGGGACTTGCCTGACCA No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370075_948370083 7 Left 948370075 2:237483299-237483321 CCTGACCAGTTATCCTTGGAACT No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370080_948370083 -6 Left 948370080 2:237483312-237483334 CCTTGGAACTGGGGTATGCCCAG No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370072_948370083 23 Left 948370072 2:237483283-237483305 CCCTCAGTGGGACTTGCCTGACC No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370070_948370083 27 Left 948370070 2:237483279-237483301 CCACCCCTCAGTGGGACTTGCCT No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370079_948370083 2 Left 948370079 2:237483304-237483326 CCAGTTATCCTTGGAACTGGGGT No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data
948370071_948370083 24 Left 948370071 2:237483282-237483304 CCCCTCAGTGGGACTTGCCTGAC No data
Right 948370083 2:237483329-237483351 GCCCAGGCAGTGAAATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948370083 Original CRISPR GCCCAGGCAGTGAAATTAAA GGG Intergenic