ID: 948371292

View in Genome Browser
Species Human (GRCh38)
Location 2:237490853-237490875
Sequence AACAGAGTTTGAATGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948371291_948371292 -3 Left 948371291 2:237490833-237490855 CCTAAATCTGACTGTAAAGGAAC 0: 1
1: 0
2: 2
3: 22
4: 171
Right 948371292 2:237490853-237490875 AACAGAGTTTGAATGCTCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 136
948371288_948371292 14 Left 948371288 2:237490816-237490838 CCATTTCTTGACCAGAACCTAAA 0: 1
1: 0
2: 1
3: 15
4: 168
Right 948371292 2:237490853-237490875 AACAGAGTTTGAATGCTCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 136
948371289_948371292 3 Left 948371289 2:237490827-237490849 CCAGAACCTAAATCTGACTGTAA 0: 1
1: 0
2: 0
3: 11
4: 147
Right 948371292 2:237490853-237490875 AACAGAGTTTGAATGCTCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948371292 Original CRISPR AACAGAGTTTGAATGCTCCC AGG Intronic
901792478 1:11661616-11661638 AACACAGGTAGAATGGTCCCAGG - Exonic
905601997 1:39260316-39260338 ACCACAGTCTGAATGCTCCTAGG + Intronic
908429195 1:64039281-64039303 AACTGAGTTGGAATGCTGACTGG + Intronic
910646222 1:89518288-89518310 AACACAGATTGAATCCTCCCAGG + Intergenic
912833113 1:112971072-112971094 GATAGAGTTAGAAAGCTCCCAGG - Intergenic
915648078 1:157288086-157288108 AACATGGTTAGACTGCTCCCAGG - Intergenic
916726373 1:167527325-167527347 AACAAAATTTAAATGCTCTCTGG + Intergenic
917932688 1:179834351-179834373 AACAGAGTTTGCTTGCTTCTTGG + Intergenic
920738780 1:208560307-208560329 AGCAGAGTTGGCATGCTTCCAGG + Intergenic
921514087 1:216068353-216068375 AAAAGAGTTTGAATGACCCTGGG + Intronic
923115731 1:230935912-230935934 AACAGAGTTTGGTGGCTGCCTGG + Intronic
923993406 1:239464993-239465015 CACAGATTTTGAATTCTCCATGG - Intronic
1066106330 10:32160590-32160612 ACCAGCGTTTGACTGCTCTCAGG + Intergenic
1069925648 10:71848813-71848835 AACAGTGTTTGAATGCTCCCTGG - Intronic
1070158556 10:73851464-73851486 GACAGAGGCTGAAAGCTCCCGGG + Intronic
1070567252 10:77613280-77613302 CACAGAGTTTAAAACCTCCCAGG + Intronic
1071924382 10:90389139-90389161 TACAGACTTAGAATTCTCCCTGG + Intergenic
1073207882 10:101778321-101778343 AACAGTGTTTGCATGGTCCTGGG + Intronic
1074402403 10:113152853-113152875 AACAGAATTTAATTCCTCCCAGG + Intronic
1077401539 11:2360555-2360577 AAGAGAGTTTGGATGCTGGCTGG + Intergenic
1080454692 11:32407596-32407618 ACAAGAGTTTGAATGTCCCCAGG - Intronic
1080878368 11:36297027-36297049 AAAACAGTTAGAATGCTGCCTGG - Intronic
1081799065 11:45844973-45844995 AGCAGAGGTTCAGTGCTCCCTGG - Intergenic
1082055852 11:47815613-47815635 AACAGAGTATGAATTCTCCCAGG - Exonic
1086569648 11:88267011-88267033 ATCAGATTGTGAATGCTTCCAGG - Intergenic
1087639443 11:100740763-100740785 AACAGTGGTTGAATCTTCCCTGG - Intronic
1088378693 11:109169756-109169778 AATAGAGTTTGTAATCTCCCAGG - Intergenic
1093857931 12:24128051-24128073 AACTGAGGTTGAATGCTTACAGG - Intergenic
1094272720 12:28635241-28635263 CACAGAGTTTCTAAGCTCCCAGG - Intergenic
1096816538 12:54205301-54205323 ATCAGAATTGTAATGCTCCCAGG + Intergenic
1103269790 12:119663816-119663838 AACAGAGATTTACTTCTCCCAGG + Intergenic
1103299455 12:119916884-119916906 CACAGAGTTTGAATTCACTCGGG + Intergenic
1106801979 13:33265090-33265112 AACAGAGTTTGTGTGCTTCAAGG - Intronic
1106977262 13:35234815-35234837 AACAGAGTTTGAGGTATCCCTGG - Intronic
1108710535 13:53028492-53028514 CACAGAGTTTGGAGGCTCCATGG - Intergenic
1110648484 13:77917106-77917128 TACAGATTTTGAGTGCTCCTTGG + Intronic
1111327181 13:86714326-86714348 AACATAGTTTGAATGTCTCCAGG + Intergenic
1112133010 13:96544256-96544278 AACGTACTTTGAATGCTCTCTGG - Intronic
1119559642 14:75579650-75579672 AACAGTTTGTGAATGTTCCCAGG + Intronic
1121291999 14:92783581-92783603 AACATAGTTTGTTTACTCCCAGG + Intergenic
1121934870 14:98009050-98009072 AAAAAAGTTTGTATGCTTCCTGG - Intergenic
1122461965 14:101903442-101903464 AACAGAGCATGAAGGCTGCCAGG + Intronic
1126856750 15:52846601-52846623 AACACACGTTGAATTCTCCCTGG - Intergenic
1128554155 15:68619210-68619232 AATAGCTCTTGAATGCTCCCTGG - Intronic
1130948338 15:88566397-88566419 AACAGAGTTTCAAAACTACCTGG - Intergenic
1131593061 15:93769672-93769694 AAGAGTGATTGAATGCTGCCAGG - Intergenic
1133567655 16:7010057-7010079 AACTAAATTTGAATTCTCCCAGG - Intronic
1135495160 16:22945023-22945045 AACAGAGATTGAATAGTCCCTGG + Intergenic
1138240974 16:55426805-55426827 AACAGAGCTTTATTTCTCCCTGG + Intronic
1139336284 16:66233923-66233945 TGCAGAGTTTGAAGGCTCACAGG - Intergenic
1140011517 16:71135991-71136013 AACAAAGTTTGAAGCTTCCCAGG + Intronic
1140559502 16:75961500-75961522 GACAGAGTTTGAACTCTCCGTGG - Intergenic
1142119569 16:88379334-88379356 AGCAGAGCTGGAAGGCTCCCGGG - Intergenic
1142209331 16:88800668-88800690 AAAAGAGTTTGAAGGCCCCTGGG - Intergenic
1149234867 17:54578101-54578123 AACAGATAATGAATGCTGCCAGG - Intergenic
1203172512 17_GL000205v2_random:162275-162297 AACAGAGTGTCAATACTCCATGG + Intergenic
1203173207 17_GL000205v2_random:170503-170525 AACAGAGTGTCAATACTCCATGG - Intergenic
1156331934 18:36130689-36130711 AATAGTTTTTGCATGCTCCCCGG + Intronic
1159856605 18:73596859-73596881 AATAGTGTTTGAATGCTGGCTGG + Intergenic
1161602136 19:5190721-5190743 AACAGACTTTTAAACCTCCCAGG - Intronic
1164722169 19:30440312-30440334 GACAGAGTTGGAAGGGTCCCTGG - Intronic
1164840133 19:31387081-31387103 CACAGACTTGGATTGCTCCCTGG - Intergenic
1165330862 19:35140558-35140580 ATCAGGGGTTGAATGCTTCCTGG - Intronic
1166182715 19:41120232-41120254 GACAGAGTTTGGAATCTCCCTGG - Intronic
927386843 2:22544366-22544388 AACAGATTTTGACTGGTTCCTGG - Intergenic
930228933 2:48824091-48824113 AGCAGAATATAAATGCTCCCTGG - Intergenic
931991507 2:67795174-67795196 ATCAGAGATTGAGTGCTCCGGGG - Intergenic
934721876 2:96584459-96584481 ACCAGATTTTGAATGTTCCCAGG - Intergenic
936820285 2:116511391-116511413 AGCTGACTTTGCATGCTCCCAGG + Intergenic
939334543 2:140808852-140808874 AACAGAGCTTGTATTCTGCCTGG - Intronic
944554257 2:200872367-200872389 AACAGGGTTTGAGAGCTTCCAGG - Intronic
945004107 2:205384884-205384906 AACAGAGTATGAGGGCTCTCAGG - Intronic
948241825 2:236444474-236444496 AACAGATCTTGAAGGCCCCCAGG + Intronic
948371292 2:237490853-237490875 AACAGAGTTTGAATGCTCCCAGG + Intronic
1168779612 20:477620-477642 ACTAGGGTTTGAATGCCCCCAGG - Intronic
1172766099 20:37351733-37351755 ATAAGAGTTTGACTGCTCCCAGG - Intronic
1176329191 21:5532145-5532167 AACAGAGTGTCAATACTCCATGG - Intergenic
1176398566 21:6288806-6288828 AACAGAGTGTCAATACTCCATGG + Intergenic
1176438591 21:6700298-6700320 AACAGAGTGTCAATACTCCATGG - Intergenic
1176462853 21:7027368-7027390 AACAGAGTGTCAATACTCCATGG - Intergenic
1176486414 21:7409146-7409168 AACAGAGTGTCAATACTCCATGG - Intergenic
1181345819 22:22219944-22219966 AACATAGTTGGAGGGCTCCCTGG - Intergenic
1183608112 22:38878811-38878833 AACAGAGTTTGTCTGCACCTGGG + Intergenic
949108768 3:232919-232941 AACAAATTTTAAGTGCTCCCTGG - Intronic
949547383 3:5083561-5083583 AACAGAGTTTGAGTGAAACCTGG - Intergenic
952042780 3:29280582-29280604 AACAGATTTTGAAAGCATCCGGG + Intergenic
954389489 3:50261152-50261174 ACCAGAAATTCAATGCTCCCTGG + Intergenic
956699034 3:71942593-71942615 ACCAGAGAGTGAATGCTTCCAGG - Intergenic
957906539 3:86564203-86564225 AACATAGTTTCTATGCTCTCTGG - Intergenic
958783222 3:98567830-98567852 AACAGAGTTTGATTTTACCCTGG - Intronic
960301701 3:116010341-116010363 AACAGAGTCTGACTTTTCCCTGG + Intronic
960892796 3:122468253-122468275 ACCAGAGTTTAGATGCTCCTTGG + Intronic
961403276 3:126662133-126662155 AATAGACTTGGAATGATCCCCGG - Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966164231 3:176999055-176999077 AACAGAAATTGCAAGCTCCCTGG + Intergenic
966926419 3:184647472-184647494 CACAGAGTTTTCATGCACCCAGG + Intronic
968112570 3:196061192-196061214 AGAAGAGTTTGAATGTTCACTGG - Intronic
969343086 4:6554557-6554579 AACAGAAATTGATTGCTCACTGG + Intronic
970359848 4:15298076-15298098 GAGAGAGTTGGAATGCTCCCTGG - Intergenic
971294791 4:25378473-25378495 AACAGAGTTTCAAAGCATCCCGG - Intronic
972768002 4:42169515-42169537 AGCAGAGATTGATTGGTCCCAGG - Intergenic
975461450 4:74658402-74658424 AACAGGCTTTGAATGCTACATGG - Intergenic
976296439 4:83477433-83477455 TACAGGGTTTTAATGCTTCCGGG + Intronic
977786759 4:101044237-101044259 AAAAGAGTTTTAATGATCTCTGG - Intronic
977983461 4:103354088-103354110 AACAGAAATTGCATGCTCCCAGG + Intergenic
978054438 4:104246187-104246209 ATCAGAGTTTGTATGTTTCCAGG + Intergenic
979618087 4:122767517-122767539 AACAGAGTGTGAAAGAACCCAGG - Intergenic
979951153 4:126895977-126895999 AACATATTTTGTATGCTACCCGG + Intergenic
983286659 4:165748555-165748577 AATGGACTTTGCATGCTCCCTGG - Intergenic
986058725 5:4166113-4166135 AACAGAGTTTGAATTTACCTAGG + Intergenic
990737515 5:58880186-58880208 CACTGGGTTTGAATGCTCACTGG - Intergenic
990923814 5:60996251-60996273 AGCAGATTATGAATGCTGCCAGG + Intronic
998726692 5:145025623-145025645 AAATGAATATGAATGCTCCCAGG + Intergenic
999855541 5:155589067-155589089 AAACGGGTTTGAATGCTTCCAGG - Intergenic
999990904 5:157048990-157049012 ATCAAGGTTTGAATGATCCCAGG + Intronic
1005957571 6:30675066-30675088 AACAGAGTTAGGAAGCTCCGAGG - Intergenic
1010371217 6:75110134-75110156 AATAAAGTTTAAATGCCCCCAGG + Intronic
1011673220 6:89704398-89704420 AACAGAGTTTGATGACTTCCTGG + Intronic
1013670602 6:112398725-112398747 GACAGAGTTTGTATGTCCCCTGG - Intergenic
1016555379 6:145330491-145330513 AACTGAATTTGGCTGCTCCCTGG + Intergenic
1020718058 7:11703190-11703212 ACCAGAGTTTGAACGCTGCCAGG - Intronic
1021150054 7:17139524-17139546 AGATGAGTTTGAATTCTCCCAGG + Intergenic
1023366317 7:39466905-39466927 AACAGATTTTGGATTCTCCTAGG + Intronic
1024837311 7:53537066-53537088 TTCAGAGTTTGAATACTCCATGG - Intergenic
1025478065 7:60952678-60952700 AACAGAATTTGAATGATAACTGG + Intergenic
1027071475 7:75162785-75162807 AACAGAGCTGGAGTCCTCCCAGG + Intergenic
1030394882 7:108973637-108973659 AACAGAGTTTGGGTGCCCCACGG + Intergenic
1031276208 7:119726923-119726945 AACAGAGTTTGAAACCTAGCTGG + Intergenic
1035285933 7:157807265-157807287 GACAGAGTAGGAATGCTTCCTGG + Intronic
1037055537 8:14435956-14435978 AAAAGTGTTTCAATGCTCCTAGG + Intronic
1037292836 8:17369349-17369371 ACCAGATTTTGACAGCTCCCTGG + Intronic
1037323178 8:17663168-17663190 AACAGAGCTGGAGTCCTCCCAGG + Intronic
1042583305 8:70306291-70306313 AACAGAGTTTCTATGAACCCAGG + Intronic
1042746134 8:72108438-72108460 AACAGACTTGGAATGGTTCCAGG - Intronic
1046379311 8:113432816-113432838 AACAGCGCTTTAATGTTCCCAGG - Intronic
1051024522 9:12591324-12591346 GACAGAGTTTCACTGCTCCCAGG + Intergenic
1055212308 9:73811542-73811564 AATAGAGTTTGAATGGTGCATGG + Intergenic
1057953130 9:99385827-99385849 ATCTGAGTTTGAAGCCTCCCTGG - Intergenic
1059470377 9:114500721-114500743 ATTTGATTTTGAATGCTCCCAGG + Intronic
1059492814 9:114683140-114683162 AACAGCCTTTGAAAGCTCACAGG + Intergenic
1061373201 9:130209453-130209475 ACCAATGATTGAATGCTCCCAGG - Intronic
1203432905 Un_GL000195v1:108178-108200 AACAGAGTGTCAATACTCCATGG + Intergenic
1188768939 X:34130006-34130028 AACAGCCTTTGAATGATGCCAGG + Exonic
1189007674 X:37011390-37011412 AACAGCCTTTGAATGATGCCAGG - Exonic
1189222730 X:39386108-39386130 AACAGAGTTTCTGTGCTCCTAGG + Intergenic
1189433910 X:40973985-40974007 AAAAGAGTTTTAATGATCTCAGG + Intergenic
1191199600 X:57765188-57765210 GACATAGTTTGAATGCTCTCTGG + Intergenic
1200660535 Y:5951422-5951444 AACAGGCTATGAATGCTGCCAGG - Intergenic