ID: 948372370

View in Genome Browser
Species Human (GRCh38)
Location 2:237497548-237497570
Sequence TGTGCTCTGCTCAAACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948372367_948372370 3 Left 948372367 2:237497522-237497544 CCGCAAGGTCAAAACACGCCTCG 0: 1
1: 0
2: 1
3: 3
4: 47
Right 948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948372370 Original CRISPR TGTGCTCTGCTCAAACCAGG TGG Intronic
900905133 1:5551802-5551824 TGTGCTCTGCACGTGCCAGGAGG + Intergenic
900987038 1:6079094-6079116 TGTGCTCCGGTCAAACCCTGGGG - Intronic
903269220 1:22177369-22177391 TGTGATCAGATCAACCCAGGTGG + Intergenic
904941939 1:34169911-34169933 TGTGGGCTTCTGAAACCAGGAGG + Intronic
905308041 1:37032740-37032762 TGTGCTCTGCCCCATCCAGATGG + Intronic
905397256 1:37674707-37674729 TGGGCTCTGCTCTACCCAGTGGG - Intergenic
915022191 1:152790609-152790631 TGTACTCTGCTAATCCCAGGTGG - Intronic
915044486 1:153000504-153000526 TCTTCTCAGCTCACACCAGGAGG + Intergenic
915801245 1:158795359-158795381 TGTGTTATGAGCAAACCAGGAGG - Intergenic
917065887 1:171092741-171092763 ATTGCTCTTCTCAAAGCAGGTGG - Exonic
917144016 1:171868361-171868383 TGTGGTCTGCTCAGGCCAAGAGG + Intronic
922057914 1:222059119-222059141 TCTGCTCTGCTCCAAGCATGTGG + Intergenic
922897046 1:229108615-229108637 TGCACTCTGATCAAACTAGGGGG + Intergenic
924897999 1:248363074-248363096 TGTGTACTGCTCAAAAAAGGTGG - Intergenic
1065681386 10:28236924-28236946 TGTGCTTTGCTCAAACCTTGTGG + Intronic
1065825988 10:29572095-29572117 TATCCTGTGTTCAAACCAGGTGG + Intronic
1072424616 10:95319698-95319720 TCTGCTCTGCTAAAACCAGAGGG + Intronic
1072823955 10:98586897-98586919 TGTTCTGTGCTCAAACCTGAGGG + Intronic
1074300165 10:112226268-112226290 TGTGCTTTTCTGGAACCAGGTGG + Intergenic
1074575333 10:114663640-114663662 TTAGCTATGCTCTAACCAGGAGG - Intronic
1078454704 11:11465899-11465921 AGTGCTCTGCTCAACATAGGGGG + Intronic
1080442704 11:32310110-32310132 TCTGCTCTGCTCAGACCTGGGGG - Intergenic
1083752457 11:64768015-64768037 TCTGCTCTACCCAAACCACGTGG + Intronic
1084496399 11:69506258-69506280 TGTACTGTGCCCAAACCATGGGG - Intergenic
1086268698 11:85033555-85033577 TGTGCTGTCCTCAAACCCAGTGG + Intronic
1090039344 11:123276589-123276611 TGTGCACTGCTGGAACCAAGAGG - Intergenic
1090278015 11:125432911-125432933 TTTGCTCTACCCCAACCAGGTGG - Exonic
1090476526 11:127026935-127026957 AGAGCTCTAGTCAAACCAGGTGG - Intergenic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1090923685 11:131231061-131231083 TGTGCTTTGGTCAACCAAGGAGG + Intergenic
1092468002 12:8751938-8751960 TTTGTATTGCTCAAACCAGGTGG + Exonic
1092693430 12:11142097-11142119 TGTGTTCTGCTCAAAAATGGAGG - Intronic
1097867298 12:64569402-64569424 TGTGCACTGCACAAAGCAGCTGG - Intergenic
1098049152 12:66434962-66434984 TCTTCTCTGATTAAACCAGGTGG + Intronic
1100656129 12:96647547-96647569 TGAGTTCTGTTCAAATCAGGTGG + Intronic
1101199080 12:102416010-102416032 TGTTCACGGCTCAATCCAGGAGG - Intronic
1101647330 12:106643329-106643351 TGTGCTATGCTCCAACCACATGG - Intronic
1101818306 12:108162748-108162770 TGACCTCTGCTCAGACCTGGAGG + Intronic
1101874113 12:108587789-108587811 TCTGCTCTGATCAGCCCAGGAGG - Intergenic
1103066030 12:117898237-117898259 TGATCTCTTCTCAAACCAGAGGG - Intronic
1104181426 12:126385595-126385617 TGTGCACTACTCAAATAAGGAGG - Intergenic
1104969163 12:132523401-132523423 TGTGCTCCTCCCAAACCCGGAGG - Intronic
1105208942 13:18246702-18246724 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1106061067 13:26292636-26292658 TGTGCTCAGCTCTAGCTAGGAGG + Intronic
1106528290 13:30563206-30563228 TGTTCTCTGTTCAAACAATGGGG + Intronic
1112065479 13:95788275-95788297 TGTGCACTGCACAAACTAAGAGG - Intronic
1113973291 13:114207111-114207133 TGTGCCTTGCCCACACCAGGTGG - Intergenic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1118816951 14:69320630-69320652 AGTGCTCAGCACACACCAGGCGG - Intronic
1122199925 14:100116299-100116321 TCTGCCCAGCTCAGACCAGGTGG + Intronic
1122200639 14:100120599-100120621 TGTGCGCTACTCAACCCATGTGG - Intronic
1202840123 14_GL000009v2_random:114070-114092 TGTGCACTCCTCAAAGCTGGTGG + Intergenic
1202909506 14_GL000194v1_random:104267-104289 TGTGCACTCCTCAAAGCTGGTGG + Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1125927968 15:43578744-43578766 TGTGCTCACCTGAACCCAGGAGG + Intronic
1125941112 15:43678315-43678337 TGTGCTCACCTGAACCCAGGAGG + Intergenic
1127692670 15:61413318-61413340 TGTGCTCAGCTCCAAGCTGGAGG + Intergenic
1128354928 15:66919414-66919436 TGTGCTCTGTTCCATCCAGCTGG - Intergenic
1129914346 15:79255095-79255117 GGTGCTCTGCTCCATCAAGGTGG + Intergenic
1129934059 15:79434588-79434610 TGCTCTCTGCTCCAGCCAGGTGG + Intronic
1131513030 15:93060016-93060038 TGTGCTCAGCTCACACCCTGTGG - Intronic
1133416307 16:5609791-5609813 AGTGCTCTGCACAAAGTAGGTGG - Intergenic
1135130752 16:19851912-19851934 TGTGTTCTGCTAAGACCAGGAGG + Intronic
1137919864 16:52476276-52476298 TGGACTCTGCTCAAACACGGAGG + Intronic
1140605030 16:76526152-76526174 TGGCCTCTGCTCAAATTAGGAGG - Intronic
1141441774 16:84033894-84033916 TGTGTTCTGCTGCAACCATGAGG - Intronic
1144647104 17:16982533-16982555 TTTGGTTTGCTAAAACCAGGAGG - Intergenic
1146353302 17:32113799-32113821 TGTGATCTGCTCTAGCCTGGGGG + Intergenic
1146738319 17:35258832-35258854 TGTGCTCTGCTGAATTCTGGTGG + Exonic
1146755047 17:35422862-35422884 TGTGCTCTGCTCAATTCTGGAGG - Exonic
1146761120 17:35479989-35480011 TGTGCTCTGCTGAATTCTGGAGG - Exonic
1149934614 17:60792444-60792466 TGTGCTCTGCTCACACTACCAGG - Intronic
1150616338 17:66775314-66775336 TGTGCTCGGCTGAAAGGAGGAGG - Intronic
1152077353 17:78168087-78168109 GGGGCTCTGCCCAGACCAGGAGG + Intergenic
1153277550 18:3382568-3382590 TGTGCTCTTCTCATACCAGCAGG - Intergenic
1153866466 18:9274114-9274136 GATGCTCTCCTGAAACCAGGAGG - Intronic
1155962857 18:32009477-32009499 TTGGTTCAGCTCAAACCAGGTGG + Intergenic
1162725617 19:12688392-12688414 TGTGGCCTGGGCAAACCAGGGGG + Intronic
1167495230 19:49813685-49813707 TGTGCCCTGCTCAAAGATGGCGG + Intronic
1168279089 19:55294438-55294460 TGTCCTATGCTCCCACCAGGTGG - Intronic
925328187 2:3038895-3038917 TGTGCCCTGGTCACCCCAGGGGG - Intergenic
925685183 2:6463936-6463958 TCTGGTCTGCTCATCCCAGGAGG + Intergenic
926054211 2:9764700-9764722 TGTGCTATGCTCAAGCCACCTGG - Intergenic
928265704 2:29809802-29809824 TGTGCTCTTCACAAACCTGCTGG - Intronic
928841507 2:35611155-35611177 TGTGCTTTACTAAAACGAGGCGG - Intergenic
929116291 2:38447231-38447253 GGTGCTCTGCTGAAACCGGTAGG + Intergenic
929500856 2:42490455-42490477 TGTGCACTGCCCAAACTAGCAGG - Intronic
929992849 2:46804099-46804121 TGTGCCCTGCTCCACCCCGGAGG - Intergenic
934177178 2:89585822-89585844 TCTGCTCAGCACAGACCAGGGGG + Intergenic
934287480 2:91660135-91660157 TCTGCTCAGCACAGACCAGGGGG + Intergenic
935900629 2:107788522-107788544 TGAGTCCTGCTAAAACCAGGGGG - Intergenic
936891778 2:117378958-117378980 TGTACCTTACTCAAACCAGGTGG + Intergenic
937170352 2:119859787-119859809 TGCTGCCTGCTCAAACCAGGTGG + Intronic
938083403 2:128382360-128382382 TTTGCTCAGCTCAAACCACAGGG - Intergenic
939514564 2:143150424-143150446 TTGGCTCTGCTCAAACTACGTGG - Intronic
940245357 2:151609696-151609718 TGTGCACTGCACAAACCTGGGGG - Intronic
940326216 2:152427862-152427884 TGTGCACTGCACAAACCCAGGGG - Intronic
942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG + Intergenic
945039271 2:205730568-205730590 TCTGCTCTGCTCAGAGCAGAGGG + Intronic
946888136 2:224245448-224245470 TGTGCTCTGCAAAAACAAGAAGG + Intergenic
948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG + Intronic
1171290118 20:23978434-23978456 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1172658317 20:36550011-36550033 TGTGCTCAGCTGAGACCAGCAGG + Exonic
1172875781 20:38163645-38163667 TGTGTTGTTCTCAAACCTGGGGG + Intronic
1173442351 20:43089340-43089362 TTTTCTCTTCTCAAACCATGAGG - Intronic
1174722619 20:52829664-52829686 TGTCCTCTGCTCTAACCTGCAGG - Intergenic
1174770508 20:53295205-53295227 TGTGCTATCCTGCAACCAGGAGG - Intronic
1176628857 21:9118975-9118997 TGTGCACTCCTCAAAGCTGGTGG + Intergenic
1176963363 21:15184935-15184957 TCTTCTCTCCTCATACCAGGAGG - Intergenic
1178640953 21:34344475-34344497 TGTTCTCTCCCCAAACCAGCGGG - Intergenic
1180107940 21:45632120-45632142 TGTGCACAGCTCTGACCAGGAGG + Intergenic
1180716429 22:17875764-17875786 TGTGCTCTGCTGCAAGCATGAGG - Intronic
1180767316 22:18352596-18352618 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1180778993 22:18509783-18509805 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1180811714 22:18767103-18767125 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1181197867 22:21201345-21201367 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1181401878 22:22654461-22654483 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1181647674 22:24242641-24242663 TGTGCTCACCTCTCACCAGGAGG - Intronic
1181703832 22:24635555-24635577 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1183255620 22:36759820-36759842 TGGGCTCTGCACCAACCAGCTGG - Intronic
1184981515 22:48099154-48099176 TGTCCTCTGATCACACCTGGGGG - Intergenic
1203228938 22_KI270731v1_random:93490-93512 TGTGCTCACCTCTCACCAGGAGG + Intergenic
949090192 3:18239-18261 TGTGCTCTGCTCTAACTAGTAGG + Intergenic
950495758 3:13333382-13333404 TGGCCTCTGATCAGACCAGGTGG + Intronic
950576798 3:13837009-13837031 TGTGCTGGGCTCCAGCCAGGAGG - Intronic
950593387 3:13955814-13955836 TGTGCACTGCACACCCCAGGTGG - Intronic
950712635 3:14823780-14823802 TGTGCACTGCACACCCCAGGTGG - Intronic
953446459 3:42972960-42972982 TATGTTCTGCTCACAGCAGGGGG + Intronic
953708203 3:45247003-45247025 TGTGTTCTTCTCAAACATGGGGG - Intergenic
957030083 3:75229958-75229980 TGTGCTCTGCTCTAACTAGTAGG + Intergenic
959778456 3:110199570-110199592 TGTTCTCTGCTCATCACAGGCGG - Intergenic
959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG + Intronic
960450507 3:117801175-117801197 TATGCTCTTCTCAAAAAAGGGGG - Intergenic
960595647 3:119405614-119405636 TGTGCCCAGCTAAAACCTGGGGG + Intronic
961404550 3:126668880-126668902 TGGCCTCTGATCAGACCAGGTGG - Intergenic
962083759 3:132168561-132168583 GGTGCTCTTCTGAAACCAGAAGG + Intronic
963432051 3:145220007-145220029 TGAGCTCTGCAGAAACCATGAGG + Intergenic
966433831 3:179861294-179861316 GGTTCTCTGTTCAATCCAGGAGG + Intronic
967933920 3:194711178-194711200 TGTGCACTGCACAATTCAGGTGG + Intergenic
971261766 4:25063715-25063737 TGTGCTCTGCTAAAATTTGGTGG - Intergenic
973832695 4:54778057-54778079 TGTGCTCTGCTAAAAGTAAGTGG - Intergenic
975994092 4:80294416-80294438 TGTGCTCTGCACCAGCAAGGTGG - Intronic
978760115 4:112348363-112348385 TGTGCTTTGCACAAGCCATGAGG + Intronic
978877535 4:113659828-113659850 TGTTCTCTCCTCAAACCAGAAGG + Intronic
982074271 4:151722816-151722838 TGTGCTGAGCTCAAAGGAGGAGG + Intronic
984278781 4:177641784-177641806 TGTGTTTTACTCAAACCAGTTGG + Intergenic
984590594 4:181613340-181613362 TGGGCTCTGCTCCCACCAGCTGG - Intergenic
985491316 5:181413-181435 TGCCCTCAGCCCAAACCAGGAGG - Intronic
986099136 5:4589657-4589679 TGTGCTCAGCTGAGAGCAGGCGG - Intergenic
988019472 5:25605468-25605490 TGGGTTCTGCGCAAAACAGGTGG + Intergenic
989150814 5:38298119-38298141 TGTTGTCTGCTCAGAGCAGGGGG + Intronic
995534858 5:113124931-113124953 TGAGCGCTGCTCCACCCAGGAGG - Intronic
995781122 5:115776356-115776378 AGTGCTTCGCACAAACCAGGTGG + Intergenic
996820878 5:127626204-127626226 TGAGCACTGCTCAACCCTGGGGG - Intergenic
996893375 5:128450209-128450231 TGTGCTCTGCTTAAGTGAGGTGG - Intronic
999502947 5:152165042-152165064 TGTGCTCTGCTCTCCCCTGGTGG + Intergenic
999512249 5:152264484-152264506 TGTGTTCTGCTGAAATGAGGGGG - Intergenic
999664288 5:153896512-153896534 TGTGCTATGCTCACACTAAGTGG - Intergenic
1001230547 5:169983688-169983710 TGTGCTCTGCTCCACCCTTGGGG - Intronic
1001849823 5:174953676-174953698 TAAGATGTGCTCAAACCAGGTGG + Intergenic
1002901123 6:1410461-1410483 TGTGCTTGGCTGAAAACAGGTGG + Intergenic
1009911348 6:69932957-69932979 TGTGTTCTGTTGAAGCCAGGTGG + Intronic
1011219133 6:85035613-85035635 TGTGCCCTGCTCAATTCAGGTGG + Intergenic
1015578895 6:134702207-134702229 TGTGCTGGGCTCAAAGCAAGTGG - Intergenic
1015772442 6:136783166-136783188 TTGGCTGTGCTCAAAGCAGGAGG + Intronic
1015816279 6:137214402-137214424 TGTACTCAGCTTAAACCTGGGGG - Intronic
1016121410 6:140346676-140346698 TGTGCTGTGCTCATACCAAAAGG - Intergenic
1020164758 7:5799139-5799161 TGAGCTATGATCATACCAGGTGG + Intergenic
1020817559 7:12924249-12924271 TTTCCTCTGTTCAAACCAAGAGG - Intergenic
1023506061 7:40900694-40900716 TGTGCTCTGCAAAAACCACGAGG + Intergenic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1032883634 7:136115664-136115686 TGTGCTCTGCTGAGAGCAGCTGG + Intergenic
1036211549 8:6844933-6844955 TGTGCCCTGCTGAGACCACGAGG + Intergenic
1039404110 8:37298120-37298142 TGTGCTCTGCTCCACCCTGAAGG + Intergenic
1039725284 8:40208767-40208789 TGTGCTCTGTTCCTACCAGATGG - Intergenic
1040593843 8:48819356-48819378 TGTGCTCTGCTCACTCGGGGAGG + Intergenic
1043381305 8:79705186-79705208 TGTGCACTGCACAAGCCTGGGGG - Intergenic
1045416101 8:101969095-101969117 TGTGCTCGGCTCAGCCCTGGGGG - Intronic
1045703675 8:104896177-104896199 TGGGCTGTGCTCAAAACAGCAGG + Intronic
1047296099 8:123571795-123571817 TGTGCACTGCACAACTCAGGAGG + Intergenic
1050016603 9:1240566-1240588 TGTGCTCTGGTCAGAGTAGGAGG - Intergenic
1051367547 9:16331878-16331900 TGTCCCCTGCTCCAACCTGGAGG + Intergenic
1054682656 9:68236451-68236473 TCTGCTCTGCTCCACCTAGGAGG + Intronic
1056808845 9:89748862-89748884 TGTTCTCTGCTCAAGCCAATGGG - Intergenic
1059060222 9:111028218-111028240 TGTGCTCTCTTGAACCCAGGAGG - Intronic
1061922230 9:133788529-133788551 TGTGCTCTGCTCCGAGGAGGCGG + Intronic
1202781819 9_KI270718v1_random:5601-5623 TCTGCTCTGCTCCACCTAGGAGG - Intergenic
1192948301 X:75989245-75989267 TGTGCTCTCCTGAAACCCAGAGG + Intergenic
1200697763 Y:6376103-6376125 TGTCCTGTGGCCAAACCAGGGGG - Intergenic
1200818768 Y:7560861-7560883 TGTGCTCTATTTAAAGCAGGTGG - Intergenic
1201036349 Y:9788596-9788618 TGTCCTGTGGCCAAACCAGGGGG + Intergenic
1201165362 Y:11204276-11204298 TGTGCGCTCCTCAAAGCTGGTGG + Intergenic