ID: 948376447

View in Genome Browser
Species Human (GRCh38)
Location 2:237524106-237524128
Sequence GGTCAAATCCTCATTGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948376447 Original CRISPR GGTCAAATCCTCATTGACAG GGG Intronic
901598402 1:10403089-10403111 GGTGACATCATCATTGACGGAGG + Exonic
901929247 1:12586272-12586294 GTTCAAATCCTGTTTCACAGTGG - Intronic
907974303 1:59415996-59416018 GGTCAAGTGCTCATTCCCAGAGG + Intronic
909305707 1:74073677-74073699 TGTTAGATCCTCATTGCCAGTGG - Intronic
909381064 1:74999122-74999144 GCACAAATTCTCATTGTCAGTGG - Intergenic
910395214 1:86786599-86786621 GGTCAAATGATCTTTGACAAGGG + Intergenic
911598312 1:99821690-99821712 GGACAAATCCACAGTCACAGTGG - Intergenic
911846887 1:102764837-102764859 GGTCATAACCTCATTGACTGTGG + Intergenic
912453973 1:109785654-109785676 GCTCAAGTCCTCCTTGGCAGTGG - Intergenic
917260846 1:173166624-173166646 GGTCAACTAATCTTTGACAGAGG - Intergenic
919577328 1:199327252-199327274 GGTCAAATGATCTTTGACAAAGG + Intergenic
919978408 1:202627648-202627670 GGTCAAACCCTCATTAACCAGGG - Intronic
920368218 1:205459794-205459816 GTTCAAACCCTCGTTCACAGAGG + Intergenic
920894311 1:210029546-210029568 GGTCAAATGATTTTTGACAGGGG - Intronic
921284588 1:213597662-213597684 GGTCCACTTCTCAGTGACAGAGG + Intergenic
922518068 1:226223309-226223331 GGTCAAATCCCCGTTAAGAGCGG - Intergenic
922964932 1:229681321-229681343 GGTCAAATGGTCTTTGACAAGGG - Intergenic
923290201 1:232538069-232538091 GTTCAAATCCTCATTAACATTGG + Intronic
923536306 1:234854750-234854772 GGCCCAATCCTCTTTGACTGGGG + Intergenic
923616413 1:235541972-235541994 GGTCAAATCTGCATTCACAGGGG + Intergenic
1063705339 10:8424911-8424933 GGTCATATGCTCATAGAAAGTGG - Intergenic
1065454557 10:25893347-25893369 GGTCAAATCAACCTTTACAGGGG - Intergenic
1066151542 10:32625289-32625311 GGTCAATTAATCTTTGACAGGGG - Intronic
1067973197 10:50993759-50993781 GAGCAAATCCTGAATGACAGTGG - Intronic
1069420423 10:68241710-68241732 GGTCAGATGCTCAGTGGCAGAGG - Intergenic
1071401194 10:85273689-85273711 GGTCAAATGATTTTTGACAGGGG + Intergenic
1072878384 10:99199563-99199585 GGTCAAATAATCCTTGACAAGGG - Intronic
1076389659 10:130089759-130089781 GGTCAAATGATCTTTGACAAGGG + Intergenic
1076760326 10:132601771-132601793 GGTCAAATGATTTTTGACAGTGG - Intronic
1077919459 11:6631914-6631936 GGCTAAATCCTCATTCTCAGGGG + Intronic
1080045112 11:27800103-27800125 GCTCAAATGCTCAATGACAGTGG - Intergenic
1080526448 11:33125867-33125889 GGTCAAAGCCTAATGGACTGGGG - Intronic
1080565245 11:33503330-33503352 ACTCAAATGCTCATTGCCAGAGG - Intergenic
1080570842 11:33555516-33555538 GGTCAAATGTTTTTTGACAGAGG + Intronic
1089775832 11:120835133-120835155 GGGCAAATGCTCAGTGACTGGGG - Intronic
1099045837 12:77718359-77718381 GGTCAAATGATCTTTGACAAGGG - Intergenic
1099415719 12:82383497-82383519 GCTCTTATCCTCATTTACAGAGG - Intronic
1100195624 12:92241186-92241208 GGGAAACTCCACATTGACAGTGG + Intergenic
1102890556 12:116555539-116555561 AGAAAAATCCTCATTGAAAGGGG + Intergenic
1103170638 12:118816419-118816441 GGTGAAATCCTCACTGATACAGG - Intergenic
1105713830 13:23041031-23041053 GGTCAAATGTTTTTTGACAGGGG - Intergenic
1110958422 13:81587328-81587350 AATCAAATCCTAATTGAAAGAGG - Intergenic
1114367767 14:22048266-22048288 GGTCACATCCTCAGTGTGAGGGG + Intergenic
1115047345 14:29012414-29012436 GGTCAACTGATTATTGACAGGGG + Intergenic
1121466291 14:94117308-94117330 GTTCAACTCCCCATTTACAGAGG - Intergenic
1121711570 14:96042664-96042686 TGGCAAATCCTCTTAGACAGAGG + Intronic
1124375870 15:29128297-29128319 GGTCAAATCCCCAGACACAGAGG - Intronic
1124494034 15:30175587-30175609 GGCCAAACCCTCATTAACTGGGG - Intergenic
1124749536 15:32363059-32363081 GGCCAAACCCTCATTAACTGGGG + Intergenic
1128262258 15:66240746-66240768 ACTCAAATCCACATTGAAAGAGG + Intronic
1131636710 15:94240552-94240574 GGTGAAATCCTTCATGACAGGGG + Intronic
1137967225 16:52947707-52947729 GGTCAAATTATCTTCGACAGGGG + Intergenic
1140060007 16:71560632-71560654 GGTCAAATGATCTTTGACAAGGG - Intronic
1142658830 17:1413455-1413477 GGTCAGATGCTGATTGGCAGGGG - Intergenic
1142998822 17:3777623-3777645 GGCCACATCCACATTGAAAGCGG + Exonic
1143033096 17:3978642-3978664 TGTCAGTTCCTCATTAACAGTGG - Intergenic
1143137743 17:4721102-4721124 GGACAATCCCCCATTGACAGTGG - Exonic
1150485769 17:65542511-65542533 TGTCAAGTCCTCATTGAGAAAGG + Intronic
1155523631 18:26694360-26694382 GGTCAAATAATCTTTGACAAGGG - Intergenic
1156203429 18:34859450-34859472 GGCCAAGTCCTCATTTACACAGG - Intronic
1157351307 18:46888941-46888963 GGTCAAATACTTTTTGACAAGGG + Intronic
1157994152 18:52535014-52535036 GATAAATTACTCATTGACAGGGG - Intronic
1159134827 18:64325555-64325577 GGTCAGATCGTAAATGACAGAGG + Intergenic
1159530235 18:69646798-69646820 GGACAGATCCTCCTTGACTGGGG - Intronic
1160215938 18:76931291-76931313 GTTTAACTCCTCATTGACTGTGG - Intronic
1165395273 19:35560456-35560478 GGACAACTCCTCGCTGACAGGGG - Exonic
1166315653 19:41988131-41988153 GGTCAAACCCTGAGGGACAGAGG + Exonic
1166417566 19:42607167-42607189 GCACAAATCCTGAGTGACAGAGG - Intronic
1166786139 19:45368471-45368493 GGTCAAATTCTCATTCATCGTGG - Intronic
927098881 2:19771543-19771565 GGTCACATTCTGATTTACAGGGG + Intergenic
928117735 2:28559483-28559505 GAGCAAATCCTCATTGGGAGTGG + Intronic
930501194 2:52220614-52220636 GGCCAAATCTTCATTCACATAGG - Intergenic
933002539 2:76943587-76943609 GGTCAAATTGTCATGGAGAGAGG - Intronic
934934600 2:98455603-98455625 CGTCGAATCCTCCCTGACAGTGG + Intronic
935501341 2:103843661-103843683 GCTCAAATCCTCTTTGAAACAGG + Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
938446068 2:131379957-131379979 AGTCAAATCCTCATTCGTAGGGG + Intergenic
941759288 2:169223570-169223592 GGTTTAACCCTCTTTGACAGTGG - Intronic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945426255 2:209707550-209707572 TGTCAACTCCTCAATGACAATGG - Intronic
948376447 2:237524106-237524128 GGTCAAATCCTCATTGACAGGGG + Intronic
1169866549 20:10206568-10206590 GGTCAAATCATTTTTGACAAAGG - Intergenic
1170112208 20:12817828-12817850 GGTCAACTCATCTTTGACAACGG + Intergenic
1170663122 20:18361899-18361921 CGGCAAATCCTCATGCACAGAGG + Intergenic
1170715499 20:18827726-18827748 GGTGAAATCCTTCTTGCCAGTGG - Intronic
1171037988 20:21731849-21731871 AGTCAAATCCTGATTGAGGGAGG + Intergenic
1171507084 20:25645914-25645936 AGTCAAATGATCATTGACAAGGG - Intergenic
1173555967 20:43965919-43965941 CTTCAATTCCTCAGTGACAGAGG + Intronic
1178017146 21:28360717-28360739 GGTCAAATTATCTTTGACAAAGG - Intergenic
1179508646 21:41858166-41858188 GGTCACATCCTCAGTGAAACTGG - Intronic
1181087899 22:20451401-20451423 CGTCATATCCTCCTAGACAGTGG - Intronic
1181984647 22:26791378-26791400 GGTGAAAACCTCAATGAAAGTGG + Intergenic
951461515 3:22956434-22956456 GGTCAAATTCTCATTCAAAAAGG + Intergenic
951859761 3:27238943-27238965 GGCCAAATCTTCATTTATAGAGG - Intronic
953645718 3:44752210-44752232 GGCCAAGTCCTCATTTACACAGG + Exonic
954856148 3:53645601-53645623 GGTCAACTGATCTTTGACAGAGG - Intronic
955377231 3:58408156-58408178 GGTCAAATAATCTTTGACAAGGG - Intronic
956492544 3:69788803-69788825 GGTCAAATGATCTTTGACAAGGG + Intronic
956788555 3:72662549-72662571 TTTGAAATCCTCATTGACTGGGG + Intergenic
956790582 3:72677075-72677097 GGTCATATCCTAATTGAAAAAGG + Intergenic
958908021 3:99963079-99963101 GGCTAAACCCTCTTTGACAGTGG - Intronic
959194251 3:103158330-103158352 GGTCAAGTCTTCATTTACACAGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
960958761 3:123054271-123054293 GGACTAAGCCTCCTTGACAGAGG - Intergenic
964848009 3:161064675-161064697 GCTCAAATCCTTTTTGACATGGG - Intronic
964948076 3:162250295-162250317 CGTCAAGTCCTCCCTGACAGAGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
966799686 3:183751231-183751253 GGTCAAATGATCTTTGACAAGGG - Intronic
966997892 3:185301758-185301780 GGTCAAATGATCTTTGACAAGGG - Intronic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
972115206 4:35622982-35623004 GGTCAAATCCTGCTTCCCAGAGG + Intergenic
977964672 4:103130845-103130867 AGTCAAATGATCATTGACAAAGG + Intronic
978375533 4:108071760-108071782 TGTCATACCCTCATGGACAGTGG - Intronic
978869533 4:113558431-113558453 TGTCAAATCCTCATATACAGAGG - Intronic
979749923 4:124266626-124266648 AGTCAACTCATCATTGACAGAGG + Intergenic
980235896 4:130106385-130106407 GGTCAATTGATTATTGACAGAGG - Intergenic
982063927 4:151634609-151634631 GGTCAAATGATCTTTGACAAGGG + Intronic
987402644 5:17493716-17493738 GGGGACATCCTCATTGACATTGG - Intergenic
987409433 5:17600004-17600026 GGGGACATCCTCATTGACATTGG - Intergenic
987413752 5:17641228-17641250 GGGGACATCCTCATTGACACTGG - Intergenic
989179663 5:38563938-38563960 TGTCAAAGCCTCACTCACAGCGG - Intronic
996205975 5:120736102-120736124 GGTCAAATGATCTTTGACAAGGG - Intergenic
997688575 5:135809679-135809701 AGACAAATCCACATGGACAGAGG - Intergenic
1003490495 6:6616989-6617011 GGTGAAATCCACATTGGCAGCGG + Intronic
1004377921 6:15106744-15106766 GGTCAAATTCCCATTCCCAGAGG - Intergenic
1008679906 6:53861199-53861221 GGCCAGGTCCTCATTGGCAGTGG + Intronic
1009910528 6:69920215-69920237 GGTCAAAGCCTCACTGGCAGTGG + Intronic
1011425818 6:87228714-87228736 GGTCAAATGATCTTTGACAAGGG - Intronic
1019077476 6:169399383-169399405 GGGCATCTCCTCATTTACAGAGG + Intergenic
1020687263 7:11310942-11310964 GGTCAAAAACTCATAGTCAGTGG + Intergenic
1021635974 7:22693616-22693638 GGTCAAATGATCTTTGACAAGGG + Intergenic
1022724601 7:32969509-32969531 GGTCAAATGATCTTTGACAAGGG - Intronic
1023359347 7:39399787-39399809 GGTCCAATCCTAATTCACTGTGG - Intronic
1025048999 7:55718323-55718345 GGTCAAATGATCTTTGACAAGGG + Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025799494 7:64772281-64772303 GGTCAACTAATCATTGACAAGGG - Intergenic
1028792503 7:94868610-94868632 GGAAAAATCCTTCTTGACAGTGG - Intergenic
1029309626 7:99650604-99650626 GGTCACATGCTCATTGAGAAAGG + Intronic
1031895826 7:127347311-127347333 GTCCAAATCCTCAGTGACTGTGG - Intronic
1033381499 7:140824431-140824453 GGTCAAATGATCTTTGACAAGGG - Intronic
1034966059 7:155391680-155391702 GGTCAAACCCTCATGGACATGGG - Intronic
1035108179 7:156459291-156459313 GGGCAACTCTTCCTTGACAGGGG + Intergenic
1036016735 8:4793704-4793726 GGCCAAATCTTCTTTTACAGGGG + Intronic
1039296418 8:36160603-36160625 CGTGAAATCCTGATTGACATAGG + Intergenic
1040036751 8:42877521-42877543 GGTCAAATACTTTTTGACAAGGG + Intronic
1042358023 8:67850773-67850795 GGTCAAATGATTTTTGACAGGGG - Intergenic
1043593385 8:81855876-81855898 GGCCAAATCTTCATTTACATAGG - Intergenic
1043733454 8:83715003-83715025 ACACAAATCCTCTTTGACAGGGG - Intergenic
1047582639 8:126233333-126233355 GGCAAAATCCTCATGTACAGAGG + Intergenic
1047934589 8:129764463-129764485 GTGCAAGTCCTCATTGAGAGTGG - Intronic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1052309322 9:27048341-27048363 TTTTAAAGCCTCATTGACAGAGG + Intronic
1052959232 9:34280436-34280458 GGTCTAATCTTCAGTGACAAAGG + Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1059999399 9:119944463-119944485 GGCCAGATCCTCAGGGACAGGGG - Intergenic
1061018713 9:127999512-127999534 GGTCAAATGATCTTTGACAATGG - Intergenic
1061954276 9:133953515-133953537 GGTCAAAACCACATTTTCAGAGG - Intronic
1188891801 X:35620551-35620573 GGTCAAGTGATCTTTGACAGGGG + Intergenic
1189123376 X:38419121-38419143 GGTCAATTGCTTTTTGACAGAGG - Intronic
1190066889 X:47247674-47247696 GATCTGATTCTCATTGACAGGGG - Exonic
1193563150 X:83044759-83044781 AGTGAAATCATTATTGACAGAGG - Intergenic
1193662324 X:84272481-84272503 GGTCAATTAATCCTTGACAGAGG + Intergenic
1194686224 X:96920646-96920668 GGTGAACTACTCATTGGCAGAGG - Intronic
1194729473 X:97437016-97437038 GGTCAAATCCTCTGTGATGGTGG - Intronic
1197996653 X:132383640-132383662 AGTCAAACCCTCAGTAACAGGGG + Intronic