ID: 948376932

View in Genome Browser
Species Human (GRCh38)
Location 2:237526954-237526976
Sequence CTAACTCATCCCATTGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948376926_948376932 25 Left 948376926 2:237526906-237526928 CCTCTGTGCACCTCAGTTTCCTC 0: 3
1: 26
2: 276
3: 1825
4: 5465
Right 948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG 0: 1
1: 0
2: 2
3: 8
4: 118
948376927_948376932 15 Left 948376927 2:237526916-237526938 CCTCAGTTTCCTCATTGTACAAA 0: 1
1: 0
2: 37
3: 335
4: 2080
Right 948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG 0: 1
1: 0
2: 2
3: 8
4: 118
948376931_948376932 6 Left 948376931 2:237526925-237526947 CCTCATTGTACAAAAGGGGTTAA 0: 1
1: 0
2: 1
3: 12
4: 164
Right 948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG 0: 1
1: 0
2: 2
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948376932 Original CRISPR CTAACTCATCCCATTGTCAT AGG Intronic
900875205 1:5337621-5337643 CAAATTCATCCCAATGTCACAGG + Intergenic
902979098 1:20110288-20110310 CAGGCTCATCCCATTGTCTTGGG + Intergenic
907947535 1:59149069-59149091 TTAACTCATTTCATTCTCATAGG - Intergenic
913566537 1:120078366-120078388 CTTATTCATCCAATTGTGATTGG - Intergenic
913631594 1:120715178-120715200 CTTATTCATCCAATTGTGATTGG + Intergenic
914287295 1:146239078-146239100 CTTATTCATCCAATTGTGATTGG - Intergenic
914548327 1:148689820-148689842 CTTATTCATCCAATTGTGATTGG - Intergenic
914618354 1:149381888-149381910 CTTATTCATCCAATTGTGATTGG + Intergenic
915203923 1:154255048-154255070 ATAACTCATCCTTTTGTCTTTGG + Intronic
918828667 1:189362180-189362202 CGAACTCAGCCCATGGTCAGAGG + Intergenic
1064245469 10:13664423-13664445 CTATCTCATCCTGTTGTCCTTGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065408547 10:25395652-25395674 TTAACTCATTCCATTGCCACAGG + Intronic
1065775872 10:29119636-29119658 TAAACCCATCCTATTGTCATCGG - Intergenic
1066456466 10:35576697-35576719 CTACCTCATGCAATTGTTATGGG - Intergenic
1069083855 10:64116828-64116850 CTGCCTCATCCAATTGTCAGAGG + Intergenic
1070362139 10:75701007-75701029 CTAACTCATCTCCTCGGCATTGG + Intronic
1072613799 10:97036190-97036212 CTAAATCATTCCACTGTCTTTGG + Intronic
1078719765 11:13873571-13873593 ATAAATCATCCCCTTGTCGTTGG + Intergenic
1082709027 11:56530329-56530351 GTATCTCCTCCCATTGACATAGG + Intergenic
1083040433 11:59680442-59680464 CAAACCCATCCCATTGGCTTAGG - Intergenic
1087025780 11:93648238-93648260 CTAACTCATCCCATTTATACTGG + Intergenic
1087127156 11:94639657-94639679 CTATCTCATCCCATTGTCTCTGG - Intergenic
1089093196 11:115895808-115895830 CTAACTCATCCCAATTTGCTGGG - Intergenic
1089120142 11:116128147-116128169 CTAACTCAAGCCACTGTCCTTGG - Intergenic
1089191170 11:116654276-116654298 CTAACACATCCCATTCACTTTGG - Intergenic
1090263861 11:125341982-125342004 CTAGCCGATCCCATTGCCATGGG + Intronic
1095497842 12:42804003-42804025 CAAATTCATCCCATTTTCTTTGG - Intergenic
1096580448 12:52581437-52581459 CTCCATCTTCCCATTGTCATGGG + Intergenic
1097623793 12:61974953-61974975 CTAAATCATCCCAAAGTAATTGG - Intronic
1099572302 12:84338216-84338238 CTAACCCAGCCCAGTGTAATAGG - Intergenic
1104110855 12:125702716-125702738 CCATCTAATTCCATTGTCATAGG + Intergenic
1109969158 13:69742526-69742548 CTAATTCATCACTGTGTCATCGG - Intronic
1111022098 13:82463934-82463956 CTAATTCACCCCAATGTCAGAGG - Intergenic
1113131799 13:107045263-107045285 CTCACTCATCCCATTCACAAGGG - Intergenic
1115898926 14:38123199-38123221 CTTACTCTTCCCATTCTCCTGGG + Intergenic
1116101282 14:40440385-40440407 TTAACTTATCACATGGTCATAGG + Intergenic
1122323281 14:100867987-100868009 CTTGCTCAACCCATTGTCTTGGG - Intergenic
1125065801 15:35484804-35484826 ATAACTAATCCAATTGTGATAGG - Intronic
1125242698 15:37594581-37594603 CTAACCCATCCCCTTGTGAAAGG + Intergenic
1131624832 15:94106522-94106544 CAAACTCATCCTAGTGTCTTAGG - Intergenic
1132046060 15:98563686-98563708 CTAACTCATTACATCTTCATTGG + Intergenic
1135433340 16:22406390-22406412 CTCACTCATGGGATTGTCATGGG + Intronic
1140929466 16:79613784-79613806 CCAAATCATCCCAATGTTATTGG - Intergenic
1141221286 16:82071333-82071355 CTAACTCATCCATTTGTTACTGG + Intronic
1147177135 17:38662944-38662966 CTAACTCATCCAATAATCAAAGG - Intergenic
1147350619 17:39840109-39840131 CTAACTCATCCCAGTTTCTTTGG - Intronic
1155751233 18:29424337-29424359 CTAAAACATGCCATTGTCTTAGG + Intergenic
1156215098 18:34989929-34989951 CTAACTCACCCCATTGAGATGGG - Intronic
1158287987 18:55906112-55906134 CTAACTCTTCCTATTGTCCTTGG - Intergenic
1159341497 18:67140096-67140118 TTTCCTCATCCCATTGACATTGG + Intergenic
1159733536 18:72063293-72063315 CTAATTCAGCACATTGACATTGG - Intergenic
1160673828 19:378155-378177 CTAACTCATCTCTTTGTGAAAGG - Intergenic
1163094810 19:15049351-15049373 ATCACTCATCCCATTGGCGTTGG + Intergenic
1163109473 19:15150682-15150704 CACACTGATCCCATTATCATCGG - Intergenic
1163803714 19:19383909-19383931 CTAACTCACCGCATTGTCCTAGG + Intergenic
1166440910 19:42814487-42814509 AAAACTCATACCATTGTGATTGG + Intronic
1166460386 19:42983098-42983120 AAAACTCATACCACTGTCATTGG + Intronic
1166477681 19:43143076-43143098 AAAACTCATACCATTGTGATTGG + Intronic
926705686 2:15835859-15835881 CCAACTCATCCCATTCAGATTGG - Intergenic
926885154 2:17590481-17590503 GCAACTCTTCCCTTTGTCATGGG - Intronic
929550688 2:42889228-42889250 GTAACTGATCACATTGTCAGAGG - Intergenic
931154466 2:59612414-59612436 CTATTTAATCCCATTGTGATTGG + Intergenic
932881966 2:75510529-75510551 CTCCCTCATACCAATGTCATGGG + Intronic
934145843 2:89093304-89093326 CTAAGTCAGCCCAGGGTCATTGG + Intergenic
934223417 2:90107264-90107286 CTAAGTCAGCCCAGGGTCATTGG - Intergenic
935373561 2:102372773-102372795 CTAACTAATCCCATTGTTATTGG + Intronic
936856640 2:116966252-116966274 CTAACTCATCCTTTTGTGCTAGG + Intergenic
946380913 2:219348300-219348322 CTGACTCATCTCTGTGTCATGGG - Intergenic
948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG + Intronic
1173711119 20:45156454-45156476 CCAACTCATCCCATTTCCAATGG + Intergenic
1177065675 21:16431363-16431385 CTAACTCCAGCCATTTTCATGGG - Intergenic
952483390 3:33785413-33785435 CTGAAACATCCCATTGCCATGGG - Intergenic
956217814 3:66868434-66868456 CTAACTTATGCCATTATTATAGG - Intergenic
958670941 3:97203059-97203081 CAAACTCCTCACATTGTCAGAGG - Intronic
961504637 3:127362074-127362096 CTGGCACATCCTATTGTCATAGG + Intergenic
969500540 4:7549916-7549938 CTAACCCATCCCACTGTCTAGGG - Intronic
971227248 4:24766054-24766076 CTAAGTCATCCCAGATTCATGGG + Intergenic
972139041 4:35933115-35933137 CTACCTCATCTCTGTGTCATGGG - Intergenic
973576419 4:52294283-52294305 CTACCTAATACCATTGTCTTGGG + Intergenic
977667409 4:99656696-99656718 CTAACTCATCAAGTTGTTATGGG - Intergenic
977830726 4:101589239-101589261 CTAATTCATCCATTTGTCCTTGG - Intronic
980863767 4:138529885-138529907 ATCACTCAGCCCATTGTCAATGG + Intergenic
981640804 4:146941589-146941611 TTTACTCATCCCTTTGCCATTGG - Intronic
983293993 4:165842378-165842400 CTGAATGATCCCATAGTCATTGG + Intergenic
984653612 4:182294114-182294136 TTAACTCAGCCAATTGTCAAAGG - Intronic
985119710 4:186627697-186627719 TTGACTCATCTCATTGTAATTGG - Intronic
985302152 4:188501705-188501727 CTAAGTCATTCAATTGTCAGAGG - Intergenic
986952571 5:13108321-13108343 CTACCCCATCTCATTGTCCTGGG + Intergenic
987039532 5:14048775-14048797 CTATCACTTCCCATTTTCATTGG + Intergenic
988440967 5:31232393-31232415 CTAACCCAACCCAGTGTCATAGG + Intronic
992279479 5:75159557-75159579 CTGTCTCATCCCATTGTCTCTGG - Intronic
992280410 5:75169658-75169680 GTAACTTATACCATTGTCCTTGG - Intronic
994568704 5:101485463-101485485 CTACCTAATCCCATTACCATAGG - Intergenic
995406194 5:111799392-111799414 CAAACACATCCCATGCTCATGGG - Intronic
996225282 5:120985655-120985677 CTAAATGATCCAATTGTAATTGG + Intergenic
996662381 5:126019752-126019774 CTAACTAGTCCCAATGTAATGGG - Intergenic
999404447 5:151294464-151294486 ATAACACATCCCATTGTAAAAGG + Intronic
1006273191 6:32980219-32980241 CCAACACATCCCATTATCCTGGG - Intronic
1007492116 6:42231223-42231245 CTAAGTCATCCCATTGTGGAAGG - Intronic
1010157744 6:72814219-72814241 CTAATTCATCCTATTCTCAGAGG - Intronic
1012417404 6:99025303-99025325 CTCACTCATCCCTCTGTCAGTGG - Intergenic
1013566996 6:111375500-111375522 CTACCTCATCCCATGGAAATTGG - Exonic
1015313031 6:131785417-131785439 CTAACTCCTACCATGATCATGGG - Intergenic
1021084716 7:16408602-16408624 CTCACTCATCACATTCTAATAGG + Intronic
1022073894 7:26946401-26946423 CTGAATCATCTCATTCTCATGGG + Intronic
1022387081 7:29911276-29911298 CAAACACATCCCATGTTCATGGG + Intronic
1028815783 7:95142747-95142769 CTAACTCATCTCATTATCATTGG - Intronic
1030136916 7:106261375-106261397 CTTACTCTTCCAGTTGTCATTGG - Intronic
1035626185 8:1072382-1072404 CAAACTCATCAAATTTTCATTGG - Intergenic
1040639003 8:49309501-49309523 CTATGTCATTCCATTCTCATTGG - Intergenic
1043488888 8:80727991-80728013 GTAACTCATGCCCTTGTAATTGG - Intronic
1044034310 8:87280073-87280095 CTAACGCATTCCATTGTCTGAGG - Intronic
1044117261 8:88350468-88350490 CAAACTCAGCCTATTTTCATTGG + Intergenic
1046393489 8:113608575-113608597 TTTACTCATCCCAGTGTCCTTGG + Intronic
1046455237 8:114450613-114450635 ATAACTCATCCCTTTGTCCGGGG - Intergenic
1047265635 8:123305673-123305695 CTAACTCATCCTAATGTGATTGG + Intergenic
1048271850 8:133035610-133035632 CTATATCATCCCATTAACATAGG + Intronic
1059699654 9:116762907-116762929 ATAACAAATCCCAATGTCATAGG - Intronic
1186187745 X:7038671-7038693 AAAACTCATACCATTGTGATTGG + Intergenic
1186893937 X:13987512-13987534 GTTCCTCATCCCATTGTCAAGGG + Intergenic
1187681248 X:21769920-21769942 ATAACTGAGCCCATGGTCATGGG + Intergenic
1189545415 X:42037514-42037536 CTAATACATCTCATTGTAATGGG + Intergenic
1195396773 X:104419438-104419460 CTGACTCATCCCACTGGTATGGG - Intergenic
1195431007 X:104789452-104789474 CTAACTTATCCCATTGACAGGGG - Intronic
1195856882 X:109341483-109341505 CTAACTCATACCATTTTTAATGG - Intergenic
1196137547 X:112226381-112226403 ATAACGCATCCCATAGTGATGGG - Intergenic
1199176567 X:144794685-144794707 CTAACTGCACACATTGTCATAGG - Intergenic
1199552480 X:149074675-149074697 CTAACCCCTCCCTTTGTCAGTGG + Intergenic