ID: 948377402

View in Genome Browser
Species Human (GRCh38)
Location 2:237530522-237530544
Sequence CTACAGTAAAAAGTCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948377402_948377405 6 Left 948377402 2:237530522-237530544 CCTCAGCTGACTTTTTACTGTAG 0: 1
1: 0
2: 0
3: 20
4: 204
Right 948377405 2:237530551-237530573 CTGGAAGCTTCCTCAACCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 194
948377402_948377404 5 Left 948377402 2:237530522-237530544 CCTCAGCTGACTTTTTACTGTAG 0: 1
1: 0
2: 0
3: 20
4: 204
Right 948377404 2:237530550-237530572 TCTGGAAGCTTCCTCAACCCTGG 0: 1
1: 0
2: 2
3: 20
4: 209
948377402_948377406 9 Left 948377402 2:237530522-237530544 CCTCAGCTGACTTTTTACTGTAG 0: 1
1: 0
2: 0
3: 20
4: 204
Right 948377406 2:237530554-237530576 GAAGCTTCCTCAACCCTGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948377402 Original CRISPR CTACAGTAAAAAGTCAGCTG AGG (reversed) Intronic