ID: 948377404

View in Genome Browser
Species Human (GRCh38)
Location 2:237530550-237530572
Sequence TCTGGAAGCTTCCTCAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948377402_948377404 5 Left 948377402 2:237530522-237530544 CCTCAGCTGACTTTTTACTGTAG 0: 1
1: 0
2: 0
3: 20
4: 204
Right 948377404 2:237530550-237530572 TCTGGAAGCTTCCTCAACCCTGG 0: 1
1: 0
2: 2
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948377404 Original CRISPR TCTGGAAGCTTCCTCAACCC TGG Intronic