ID: 948381560

View in Genome Browser
Species Human (GRCh38)
Location 2:237553721-237553743
Sequence GCAGGTGGGAGTCCATGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948381560_948381566 16 Left 948381560 2:237553721-237553743 CCTCCACATGGACTCCCACCTGC 0: 1
1: 0
2: 4
3: 35
4: 341
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381560_948381567 17 Left 948381560 2:237553721-237553743 CCTCCACATGGACTCCCACCTGC 0: 1
1: 0
2: 4
3: 35
4: 341
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948381560 Original CRISPR GCAGGTGGGAGTCCATGTGG AGG (reversed) Exonic