ID: 948381563

View in Genome Browser
Species Human (GRCh38)
Location 2:237553735-237553757
Sequence GTCGCTGTCCACTTGCAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948381563_948381570 21 Left 948381563 2:237553735-237553757 CCCACCTGCAAGTGGACAGCGAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 948381570 2:237553779-237553801 CTGGGTTTACTGATGACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 136
948381563_948381566 2 Left 948381563 2:237553735-237553757 CCCACCTGCAAGTGGACAGCGAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381563_948381567 3 Left 948381563 2:237553735-237553757 CCCACCTGCAAGTGGACAGCGAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948381563 Original CRISPR GTCGCTGTCCACTTGCAGGT GGG (reversed) Exonic