ID: 948381564

View in Genome Browser
Species Human (GRCh38)
Location 2:237553736-237553758
Sequence TGTCGCTGTCCACTTGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948381564_948381567 2 Left 948381564 2:237553736-237553758 CCACCTGCAAGTGGACAGCGACA 0: 1
1: 0
2: 8
3: 81
4: 229
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381564_948381566 1 Left 948381564 2:237553736-237553758 CCACCTGCAAGTGGACAGCGACA 0: 1
1: 0
2: 8
3: 81
4: 229
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381564_948381570 20 Left 948381564 2:237553736-237553758 CCACCTGCAAGTGGACAGCGACA 0: 1
1: 0
2: 8
3: 81
4: 229
Right 948381570 2:237553779-237553801 CTGGGTTTACTGATGACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948381564 Original CRISPR TGTCGCTGTCCACTTGCAGG TGG (reversed) Exonic