ID: 948381566

View in Genome Browser
Species Human (GRCh38)
Location 2:237553760-237553782
Sequence TCAGTCCTGCACTGCTCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948381564_948381566 1 Left 948381564 2:237553736-237553758 CCACCTGCAAGTGGACAGCGACA 0: 1
1: 0
2: 8
3: 81
4: 229
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381559_948381566 17 Left 948381559 2:237553720-237553742 CCCTCCACATGGACTCCCACCTG 0: 1
1: 0
2: 0
3: 26
4: 259
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381563_948381566 2 Left 948381563 2:237553735-237553757 CCCACCTGCAAGTGGACAGCGAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381565_948381566 -2 Left 948381565 2:237553739-237553761 CCTGCAAGTGGACAGCGACATTC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381560_948381566 16 Left 948381560 2:237553721-237553743 CCTCCACATGGACTCCCACCTGC 0: 1
1: 0
2: 4
3: 35
4: 341
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175
948381561_948381566 13 Left 948381561 2:237553724-237553746 CCACATGGACTCCCACCTGCAAG 0: 1
1: 0
2: 0
3: 22
4: 181
Right 948381566 2:237553760-237553782 TCAGTCCTGCACTGCTCACCTGG 0: 1
1: 1
2: 0
3: 6
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948381566 Original CRISPR TCAGTCCTGCACTGCTCACC TGG Exonic