ID: 948381567

View in Genome Browser
Species Human (GRCh38)
Location 2:237553761-237553783
Sequence CAGTCCTGCACTGCTCACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948381563_948381567 3 Left 948381563 2:237553735-237553757 CCCACCTGCAAGTGGACAGCGAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381559_948381567 18 Left 948381559 2:237553720-237553742 CCCTCCACATGGACTCCCACCTG 0: 1
1: 0
2: 0
3: 26
4: 259
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381561_948381567 14 Left 948381561 2:237553724-237553746 CCACATGGACTCCCACCTGCAAG 0: 1
1: 0
2: 0
3: 22
4: 181
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381565_948381567 -1 Left 948381565 2:237553739-237553761 CCTGCAAGTGGACAGCGACATTC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381560_948381567 17 Left 948381560 2:237553721-237553743 CCTCCACATGGACTCCCACCTGC 0: 1
1: 0
2: 4
3: 35
4: 341
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262
948381564_948381567 2 Left 948381564 2:237553736-237553758 CCACCTGCAAGTGGACAGCGACA 0: 1
1: 0
2: 8
3: 81
4: 229
Right 948381567 2:237553761-237553783 CAGTCCTGCACTGCTCACCTGGG 0: 1
1: 0
2: 3
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948381567 Original CRISPR CAGTCCTGCACTGCTCACCT GGG Exonic