ID: 948382674

View in Genome Browser
Species Human (GRCh38)
Location 2:237561670-237561692
Sequence GTGGTTAAGTATCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948382674_948382680 23 Left 948382674 2:237561670-237561692 CCAAGATGGTGATACTTAACCAC No data
Right 948382680 2:237561716-237561738 TTCCCTTATCCAAAGTACTTGGG No data
948382674_948382679 22 Left 948382674 2:237561670-237561692 CCAAGATGGTGATACTTAACCAC No data
Right 948382679 2:237561715-237561737 GTTCCCTTATCCAAAGTACTTGG No data
948382674_948382675 -5 Left 948382674 2:237561670-237561692 CCAAGATGGTGATACTTAACCAC No data
Right 948382675 2:237561688-237561710 ACCACCACTATCACCACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948382674 Original CRISPR GTGGTTAAGTATCACCATCT TGG (reversed) Intergenic
No off target data available for this crispr