ID: 948382716

View in Genome Browser
Species Human (GRCh38)
Location 2:237561992-237562014
Sequence GAATTCCATCAGAATTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948382716_948382726 15 Left 948382716 2:237561992-237562014 CCCCACAAATTCTGATGGAATTC No data
Right 948382726 2:237562030-237562052 CAGGCATTAGGAGGTTTTTAAGG No data
948382716_948382720 -4 Left 948382716 2:237561992-237562014 CCCCACAAATTCTGATGGAATTC No data
Right 948382720 2:237562011-237562033 ATTCATTCCAGGTACAGCCCAGG No data
948382716_948382723 6 Left 948382716 2:237561992-237562014 CCCCACAAATTCTGATGGAATTC No data
Right 948382723 2:237562021-237562043 GGTACAGCCCAGGCATTAGGAGG No data
948382716_948382722 3 Left 948382716 2:237561992-237562014 CCCCACAAATTCTGATGGAATTC No data
Right 948382722 2:237562018-237562040 CCAGGTACAGCCCAGGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948382716 Original CRISPR GAATTCCATCAGAATTTGTG GGG (reversed) Intergenic
No off target data available for this crispr