ID: 948383318

View in Genome Browser
Species Human (GRCh38)
Location 2:237566603-237566625
Sequence GGGCCAGGCCCAGCATCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 1, 2: 7, 3: 45, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948383318_948383326 16 Left 948383318 2:237566603-237566625 CCTGCTGATGCTGGGCCTGGCCC 0: 1
1: 1
2: 7
3: 45
4: 399
Right 948383326 2:237566642-237566664 TCGTACCCATCGGCACTCCATGG 0: 1
1: 0
2: 0
3: 2
4: 21
948383318_948383325 6 Left 948383318 2:237566603-237566625 CCTGCTGATGCTGGGCCTGGCCC 0: 1
1: 1
2: 7
3: 45
4: 399
Right 948383325 2:237566632-237566654 GAGCTGCAAGTCGTACCCATCGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948383318 Original CRISPR GGGCCAGGCCCAGCATCAGC AGG (reversed) Exonic
900299641 1:1970260-1970282 AGGGCAGGCCCAGCAGCACCAGG + Intronic
900390453 1:2431712-2431734 GGGGCAGGGCCAGCAGCAGAAGG - Intronic
900599360 1:3496523-3496545 GGGCCAGGCCCAGCCAGAGGGGG + Intronic
900659640 1:3776178-3776200 GGCCTGGGCCCAGCCTCAGCAGG + Intergenic
900935996 1:5766605-5766627 GGGCCTGGCCCACCTTGAGCAGG + Intergenic
901271317 1:7954144-7954166 AGACCAGGCCCAGCAGCACCCGG + Intergenic
901743757 1:11359179-11359201 TGGCCTGGCCCAGCTTCAGTGGG + Intergenic
901812619 1:11776516-11776538 GGGCCAGGCCCAGGGGCAGCAGG + Exonic
901916871 1:12506794-12506816 GGGCTTCGCCCAGCATCAGGGGG - Intronic
902683956 1:18063660-18063682 AGGCCTGGCCCAGCAGCAGCTGG + Intergenic
903213572 1:21831421-21831443 AGGTAAGGCCCAGCCTCAGCTGG + Intronic
903376335 1:22868689-22868711 CGGCCAAGCCCAGCATCAGTGGG + Intronic
903522264 1:23959709-23959731 CGGCCAGCCCCAGCAACAGGCGG + Intronic
903564878 1:24257786-24257808 GGGCCAGGCCAGGCTTCAGGAGG - Intergenic
903673105 1:25047970-25047992 GGGCCAGGTCCAGCCTCTGTGGG + Intergenic
903678367 1:25080929-25080951 GGGCCAGGCCTGGCAGGAGCTGG - Intergenic
904468835 1:30723491-30723513 GGGCCTGGAGCAGCAGCAGCAGG + Exonic
904864016 1:33562261-33562283 GGCCCTGGACCAGGATCAGCAGG + Intronic
905183103 1:36178531-36178553 GCGCCAGGCCCGGGAGCAGCGGG + Exonic
905231991 1:36520352-36520374 GGAAGAGGCCCAGCCTCAGCAGG + Intergenic
905478260 1:38244080-38244102 GTGCCAGGCCCAGCCTGGGCTGG - Intergenic
906305666 1:44717277-44717299 AGGCCAGCCCCAGCTTCTGCAGG - Intronic
907313339 1:53552318-53552340 GGCCCAGGCACAGGAGCAGCGGG - Intronic
907431290 1:54413535-54413557 TGGCCAAGCCCAGCATCAATGGG + Intergenic
908264116 1:62361602-62361624 GGTCCAGGCCCATCAAGAGCAGG + Intergenic
908354968 1:63319943-63319965 GGGCCGGACCCAGCATCAGATGG + Intergenic
911895203 1:103424850-103424872 GGCTCAGGCCCAGCATGAGCAGG - Intergenic
912748740 1:112268085-112268107 CTGACAGGCCCAGCATCTGCTGG - Intergenic
914820864 1:151101698-151101720 GGTCCAGCCCCAGCATCACCAGG + Intronic
915355790 1:155254757-155254779 GGACCAGCCCCAGCGTAAGCAGG + Exonic
915637818 1:157198823-157198845 GGGCCTGGTCTTGCATCAGCAGG + Intergenic
915704594 1:157831938-157831960 GGGCCAGGTCAAGCAACACCAGG + Exonic
915735882 1:158084600-158084622 GGGCTAGGCCCAGGAGGAGCTGG - Intronic
916008761 1:160685451-160685473 GAGCCAGGCCCAACCTCAGTTGG - Intronic
916519286 1:165549208-165549230 GGGGCTGGACCAGCAGCAGCAGG + Intronic
916572137 1:166037294-166037316 GGGCCAGGCTCAGAAGGAGCGGG - Intergenic
917817599 1:178725835-178725857 GAGCCAGGACCAGCAGAAGCCGG + Intronic
920262379 1:204698050-204698072 GGGCCAAGCCTGGCATCACCAGG - Intergenic
920310826 1:205047290-205047312 GGGCCAGGCCAGGCTGCAGCTGG - Intronic
922765678 1:228155453-228155475 GGGCCAGGCTCAGGATTGGCTGG + Intronic
923369364 1:233295334-233295356 GGGCCAGGGGCAGCAGCAGGAGG + Exonic
924787430 1:247211047-247211069 GGGCCAGGCCCAGCGCAAGCAGG - Intergenic
1065599074 10:27350170-27350192 GGGCCAGGGCCAGGGGCAGCGGG + Intergenic
1065855746 10:29828584-29828606 GGCCCAGGCCCAGCACCATCTGG - Intergenic
1066276243 10:33871357-33871379 GGTCCAGCCCCATCATCAGAGGG - Intergenic
1066456549 10:35577252-35577274 TGGCCAGGGCCAGCAGAAGCTGG + Intergenic
1066524904 10:36266996-36267018 GGGCCAATCCCTGCCTCAGCAGG - Intergenic
1067053750 10:43039740-43039762 GGGCCAGGCCCAGCTGCCTCAGG + Intergenic
1068283535 10:54908186-54908208 GGGCCAGGCTCACCCTCGGCAGG - Intronic
1069211075 10:65760691-65760713 GGGCCAGGCCCAGGGTCCCCAGG - Intergenic
1070147545 10:73785825-73785847 GGCCCAGGCCCCGGATCCGCGGG + Exonic
1071089258 10:81899694-81899716 GGGCCAGGCCCTTCATCTTCAGG - Intronic
1071289906 10:84181149-84181171 GGGCTGGGCTCAGCATCAGAGGG + Intronic
1072549037 10:96463368-96463390 GGTCCTGGCCCATCAGCAGCAGG + Intronic
1072783049 10:98262962-98262984 GGGGCTGGCCTAGCAGCAGCAGG + Exonic
1072810272 10:98456179-98456201 TGGCGAGGCCCAGCATCTGCAGG - Intergenic
1074128210 10:110547404-110547426 GGGCCATGTTCAACATCAGCAGG - Intergenic
1074772333 10:116742269-116742291 GGGCCGGGGTCAGCAGCAGCGGG - Intronic
1074945644 10:118278295-118278317 GGAGCAGGGCCAGAATCAGCAGG + Intergenic
1075261869 10:120970250-120970272 GGCTCAGGCCCAGCATGAACGGG - Intergenic
1076450579 10:130554577-130554599 AGGCCAGACCCAGTGTCAGCAGG + Intergenic
1076704919 10:132296045-132296067 GTGACAGGGCCAGCATCGGCAGG + Intronic
1077106472 11:844558-844580 GGGCCAGGCCCAGGCTCCCCAGG - Exonic
1077113514 11:872541-872563 GGGCCTGGCCCAGCCACAGGAGG - Intronic
1077154660 11:1085957-1085979 GGGCCAGGGACAGCATCAACAGG - Intergenic
1077180103 11:1208476-1208498 GGGGCAGGCCGAGCAGCAGAGGG - Intergenic
1077235937 11:1482034-1482056 GGGCCAGGCCCAGCGTCATGGGG - Intronic
1077246959 11:1544366-1544388 GGGCCATCCCCAGCACCAGAAGG + Intergenic
1077437137 11:2548127-2548149 AGGCCAGGCCCAGGATAAGGTGG + Intronic
1077468539 11:2745805-2745827 GGGCCAGGACCAGGAGCAGGCGG + Intronic
1078180673 11:9007420-9007442 TGGCCAGCCCCTGCCTCAGCAGG - Intergenic
1079115719 11:17639386-17639408 GGGCCAGGCCCCACTTCATCAGG - Intronic
1079243614 11:18737830-18737852 GGGGCAGGCTCAGCTTCACCTGG - Intronic
1081657829 11:44868918-44868940 AGACCAGGGCCAGCATCACCTGG - Intronic
1081873934 11:46396318-46396340 GGGCCAGGCCCAGGTTCTCCCGG - Intergenic
1083176019 11:60951038-60951060 CGGCCAGGCCGAGTAGCAGCAGG + Exonic
1083615651 11:64024815-64024837 GGTCAAGGCCCAGCCCCAGCTGG + Intronic
1083960399 11:66012062-66012084 GGGCCAGGCCCAGCGCCAGCGGG - Exonic
1084660579 11:70544284-70544306 GGGCCAGTCCCAGCAGCTACGGG + Intronic
1084895339 11:72263219-72263241 GGGCCATGCTCACCATCAGTGGG - Intergenic
1084958884 11:72705902-72705924 GGGCCAGACCCAGAATCACCTGG + Intronic
1087974764 11:104531216-104531238 GTGCTAGACCCAGCATCAGTAGG - Intergenic
1088630106 11:111766318-111766340 GGGACCGGCCCAGGAGCAGCGGG - Exonic
1089126648 11:116181060-116181082 GGGGCAGGCCCAGCAAGAGGAGG - Intergenic
1089560343 11:119340358-119340380 CCGCCAGGCCCAGGAGCAGCAGG + Exonic
1089745849 11:120616239-120616261 GGGCCAGCCCCAGGAGCAGAGGG + Intronic
1090744655 11:129696215-129696237 GGGCCAGGCCAGGCTCCAGCAGG + Intergenic
1091238066 11:134034757-134034779 GGGCCAATGCCAGCATCAGAGGG - Intergenic
1091439547 12:501968-501990 GGGGAAGGCCCTGCCTCAGCTGG - Intronic
1091677528 12:2502062-2502084 GGGCAAGGGCCAGGCTCAGCAGG - Intronic
1095950320 12:47778235-47778257 AGGCCAGGCCCAGGAAAAGCTGG + Intronic
1096509831 12:52121593-52121615 AGGCCATGCCCAGCCTCAGAGGG - Intergenic
1096744448 12:53716259-53716281 AGGCCAGGCCCAGCAGCGGGTGG - Exonic
1098202361 12:68069228-68069250 GAGCCTGGAGCAGCATCAGCTGG - Intergenic
1101828524 12:108239608-108239630 TGGCCATGCCCATCATCAGTAGG + Intronic
1101992829 12:109501313-109501335 GGCCCTGGCCCTGCATCAGATGG + Intronic
1102747171 12:115259274-115259296 CGGCCAGTGCCAGCATGAGCAGG - Intergenic
1103725313 12:122994831-122994853 AGGCCAGGACCAGCCCCAGCGGG + Exonic
1103742920 12:123103532-123103554 AGGCCAAGCCCAGCCTCCGCTGG - Intronic
1103870618 12:124088683-124088705 GGACCAAAGCCAGCATCAGCAGG + Intronic
1103898993 12:124293792-124293814 GGCGCAGGCCCTGCAGCAGCAGG - Intronic
1104146918 12:126043354-126043376 TGGCCATGTCCAGCATCAGATGG + Intergenic
1104760469 12:131295071-131295093 GGGACGGGCCCAGGATCAGCGGG + Intergenic
1104819309 12:131665714-131665736 GGGACGGGCCCAGGATCAGCGGG - Intergenic
1107496751 13:40933766-40933788 GGGCCCTGCCCAGGTTCAGCAGG - Exonic
1110933052 13:81247167-81247189 AGGCCAGGCCTAAAATCAGCAGG - Intergenic
1113557857 13:111253010-111253032 GGGCCAGGCCCAGCAGCAGCTGG + Intronic
1113810742 13:113141077-113141099 TGGCCCGGCCCAGCGGCAGCGGG - Intronic
1114221251 14:20699419-20699441 GGACCAGCCCCAGCCCCAGCAGG - Exonic
1114267514 14:21081625-21081647 GGGCCAGGGCCCGCATCTCCTGG - Exonic
1114648310 14:24267917-24267939 GGTCCAGTGCCCGCATCAGCAGG + Exonic
1114650381 14:24280928-24280950 GGGCCAGGCCTCGCAGCACCGGG + Intergenic
1114655957 14:24315813-24315835 GGGCCAGGTTCAGCACCATCAGG - Exonic
1115869772 14:37786573-37786595 GGGCCAGGCACCGCCTCACCCGG - Intronic
1116849459 14:49893466-49893488 GGGCCGGGCCGCGCCTCAGCAGG + Exonic
1118225160 14:63891800-63891822 GGTCCCGGCCAAGCAGCAGCTGG + Intronic
1118258450 14:64225397-64225419 AGGCCAGGAGCAGCAGCAGCAGG - Exonic
1119213698 14:72851876-72851898 TGGCCAGGCCCGCCACCAGCTGG + Intronic
1119926943 14:78503611-78503633 TGGTCAGGACCACCATCAGCAGG + Intronic
1120881691 14:89418773-89418795 GGGGCAGGACCTGCATTAGCCGG - Intronic
1121279180 14:92687357-92687379 GGGGAAGGCCCGGCATGAGCAGG - Intronic
1122113501 14:99516753-99516775 CTGCCAGGCCCAGCCTCTGCAGG - Intronic
1122151601 14:99728868-99728890 GGACTAGGCCCAGCCACAGCAGG - Intergenic
1122205272 14:100145163-100145185 AGGCCAGGCCCAGGGTCAGAGGG - Exonic
1122825719 14:104369531-104369553 GAGCCAGGCCCAGCCCCACCAGG + Intergenic
1122862019 14:104586982-104587004 GGGCCAGACTCAGCATGGGCAGG + Intronic
1122862446 14:104588636-104588658 GGCCCAGGGCCAGCACGAGCAGG - Exonic
1122892057 14:104736591-104736613 GTGCCATGGCCAGCCTCAGCGGG + Intronic
1122980852 14:105191818-105191840 GGGGCGGGCCCAGCAGCAGCAGG + Intergenic
1123030686 14:105449746-105449768 GGGCCAGCCCCAGAAGCAGCAGG - Intronic
1123936940 15:25198612-25198634 GGGACAGGACCATCAACAGCAGG - Intergenic
1124803060 15:32853818-32853840 GGGCCAGGCCCAGAGTGGGCAGG + Intronic
1125764137 15:42121829-42121851 GGGCCAGGCCCAGAGCCAGCCGG - Intergenic
1125933348 15:43615624-43615646 GGGCCCGACCCAGCATCCCCTGG + Exonic
1125946446 15:43715086-43715108 GGGCCCGACCCAGCATCCCCTGG + Intergenic
1126865656 15:52934045-52934067 GGGCCAAGCCCAACATCAACAGG - Intergenic
1127288297 15:57549209-57549231 AGGCCAGGCCCAGTCACAGCTGG + Exonic
1128791269 15:70435582-70435604 GGGCCAGGCCCAGTTACATCAGG + Intergenic
1129444674 15:75608604-75608626 AGGGAAGCCCCAGCATCAGCTGG + Intronic
1129781545 15:78275280-78275302 GGGCCAAGCCCAGCATGCACAGG - Intronic
1129831286 15:78672584-78672606 GCCCCATGCACAGCATCAGCAGG - Intronic
1129844956 15:78763947-78763969 GGGCCCAGCCCTGCCTCAGCTGG - Exonic
1129880553 15:79003737-79003759 GGGCCAGGCTGAGCCTCAGTGGG + Intronic
1130256870 15:82329893-82329915 GGGCCCAGCCCTGCCTCAGCTGG + Intergenic
1130598078 15:85260095-85260117 GGGCCCAGCCCTGCCTCAGCTGG - Intergenic
1130885003 15:88085311-88085333 GGGCCAAGCCCAGAGTCAGTGGG - Intronic
1131205200 15:90439338-90439360 GGGCCAGGCCTAGCTTGAACAGG - Exonic
1131804743 15:96109681-96109703 GTGCCAGGGCCAGCACCAGTGGG + Intergenic
1131847030 15:96498923-96498945 TGGCCAAGCCCAACATCAACGGG - Intergenic
1132499137 16:276929-276951 GAGCCAGGCCCAGGATCTTCAGG + Intronic
1132567401 16:629832-629854 AGGCCAGACCCAGCAGCAGGCGG - Intronic
1132602886 16:781784-781806 GGGCCCTGCCCAGCAGCAGCAGG - Intronic
1132745938 16:1436312-1436334 GGGCCAGGCCCGGGCTCAGGGGG + Intronic
1132834597 16:1946507-1946529 GGGCATGCCCCAGCCTCAGCTGG - Intronic
1132840869 16:1977997-1978019 TGGCCAGGCCCAGCGCCCGCAGG - Exonic
1132888407 16:2192694-2192716 GAGCCAGGCACAGCAGCTGCGGG - Intronic
1132895627 16:2228146-2228168 GGGCCAGACCCACCCTCAGGAGG - Intronic
1132992681 16:2805093-2805115 GGGCAAGGAGCAGCAACAGCTGG - Intergenic
1133127829 16:3657653-3657675 GGGCCTGGCTCAGCACCCGCAGG - Intronic
1133303319 16:4795961-4795983 GGGCGACGACCAGCAGCAGCAGG - Exonic
1133317165 16:4892042-4892064 GGGCCAAGTCCAGCAGCTGCAGG + Exonic
1133773657 16:8882326-8882348 GAGCCAGGCCCAGCAAGAGGTGG + Intergenic
1134626602 16:15726955-15726977 GGGCCAGGCCAAGCAGGAGGTGG - Exonic
1135146553 16:19967632-19967654 GGGCCAAGCCCAGTATCAGTGGG - Intergenic
1135937338 16:26792580-26792602 GGGCAAGGCCCAGCAACATGTGG - Intergenic
1136271714 16:29152526-29152548 GGGCCAGGCCCGCCTTCACCAGG - Intergenic
1136286855 16:29249165-29249187 GAGCCGGGGCCAGCAGCAGCTGG - Intergenic
1136545068 16:30949940-30949962 GGGACGGGCCCACCTTCAGCTGG - Intronic
1137677005 16:50308726-50308748 CGGCCAGGGTCAGCCTCAGCAGG - Exonic
1138483101 16:57317186-57317208 GGGCCAGGCCCAGGGCCTGCCGG + Intergenic
1139259404 16:65577504-65577526 GGGTCAGGCCCAGCTTCCCCAGG + Intergenic
1139335229 16:66226652-66226674 GGGCCAGGGCCAGGGCCAGCAGG - Intergenic
1139558285 16:67726511-67726533 GGCCCAGGGCGAGCATCAGAGGG + Exonic
1139939186 16:70592208-70592230 GGCCCCAGCCCAGCCTCAGCCGG - Intronic
1141313523 16:82938520-82938542 TGGCACTGCCCAGCATCAGCAGG + Intronic
1141495778 16:84408422-84408444 GGGCAGAGCCCAGCAGCAGCAGG - Exonic
1141629275 16:85277854-85277876 GGCAGAGGCCCAGCAGCAGCTGG - Intergenic
1141889364 16:86916448-86916470 TGGGCAGGTCCAGCATCTGCAGG + Intergenic
1141948354 16:87325090-87325112 TGGCCATGCCCAACACCAGCAGG - Intronic
1142075380 16:88114686-88114708 GGGCCAGGCCCGCCTTCACCAGG - Intronic
1142225733 16:88876894-88876916 AGGCCAGGCACAGCATCCGGTGG + Exonic
1142263107 16:89051620-89051642 CTGCCAGCCACAGCATCAGCTGG - Intergenic
1142711877 17:1727926-1727948 GGCCCAGCCGCACCATCAGCTGG - Exonic
1143108607 17:4541516-4541538 GACCAAGGCGCAGCATCAGCAGG - Exonic
1143537352 17:7549219-7549241 GGCCCAGGCCCAGCGCGAGCGGG - Exonic
1143734449 17:8900677-8900699 GGGCCAGGCAGGGCAGCAGCTGG - Intronic
1144519099 17:15942612-15942634 AGCCCAGGCCCAGCAGCTGCAGG + Intergenic
1144675878 17:17161299-17161321 GGCCCAGGGCCACCCTCAGCTGG - Exonic
1144731513 17:17528873-17528895 GGCCCAGGCCCAGCAGCATGAGG + Intronic
1144732602 17:17537283-17537305 GGGCCAGGCCCAGGAGCAGGTGG - Intronic
1144739738 17:17575161-17575183 AGGCCAGGCCCACCAGAAGCTGG - Intronic
1145061539 17:19737361-19737383 GGGACAGGCCCAGCCTCAGCAGG + Intergenic
1146467253 17:33095942-33095964 GGGCTTGGCCCATCAGCAGCTGG + Intronic
1147240035 17:39084799-39084821 AGGCCAGGCACAGGAGCAGCAGG + Intronic
1147567752 17:41548022-41548044 GGGCCAGGCCTGGCAGCACCAGG - Intergenic
1147654635 17:42081878-42081900 GGGTGAGGCCCAGCATCAACAGG + Intergenic
1147655442 17:42088185-42088207 CTCCCAGACCCAGCATCAGCAGG - Intergenic
1147686528 17:42289423-42289445 GATCCAGGCCCAGCAGCTGCAGG + Exonic
1148241420 17:46001819-46001841 GGGCCAGTCACAGCAGCAGGAGG + Intronic
1148322462 17:46765782-46765804 GGGCCAGGCCCTTCATGTGCAGG + Intronic
1148327110 17:46789768-46789790 GGGCCAGGGCCAGGCCCAGCTGG - Intronic
1148864696 17:50622463-50622485 GGTCCAGTCCCTGCCTCAGCTGG - Intronic
1149866708 17:60155068-60155090 GGGCCAGGCCAAGCAGCCACTGG - Intronic
1150060469 17:62065016-62065038 GGGCGAGGCCCAGCCGGAGCCGG - Intronic
1151655190 17:75492533-75492555 GGGACAGGCTCAGCATCTCCAGG - Exonic
1151691976 17:75692169-75692191 TGGCCTGTCCCAGCATCAGGAGG + Intronic
1151877221 17:76873662-76873684 GGGCTGGGCCCAGCTTCAGGAGG - Intronic
1152573701 17:81131210-81131232 GGGCCGGGCCGGGCATGAGCGGG + Intronic
1152586407 17:81191385-81191407 GGGCCAGGGCCAGCCTCAGGGGG + Intronic
1152760795 17:82106084-82106106 TGGGCAGGCTCAGCAGCAGCAGG - Intronic
1203170583 17_GL000205v2_random:145046-145068 GGGCCAGGCCCTGCACATGCTGG - Intergenic
1153954927 18:10088011-10088033 GGTCTAGGCTCAACATCAGCAGG - Intergenic
1156376969 18:36523462-36523484 AGGCCACATCCAGCATCAGCAGG + Intronic
1157501625 18:48194650-48194672 GGGACAGGCCCAGCATCACCAGG + Intronic
1159787608 18:72732924-72732946 TGGCCAAGCCCAGAATCAGTGGG - Intergenic
1160730549 19:639934-639956 AGGCCAGGCCCAGCCACAGGCGG - Exonic
1160963249 19:1734109-1734131 GCTCCAGGCCTGGCATCAGCGGG + Intergenic
1161081431 19:2312482-2312504 GGTCAAGCCCCAGCTTCAGCAGG - Intronic
1161852143 19:6743208-6743230 GCGGCGGGCCCAGCAGCAGCTGG + Exonic
1162299526 19:9836166-9836188 GGAGCAGGCCCAGCATCTGTGGG + Intronic
1162602296 19:11677881-11677903 GGGAGAGGCTCAGCATCAGAGGG + Intergenic
1162911060 19:13847895-13847917 GGGCGAGGCCGAGCCTCAGCCGG + Intergenic
1163243169 19:16076604-16076626 GATCCAGGCCCTGCAGCAGCAGG + Intronic
1163474534 19:17517320-17517342 GGCCCACCCCCAGGATCAGCAGG - Exonic
1163769059 19:19179781-19179803 TGGCCAGGCCCAGGACCAGATGG - Intronic
1164400176 19:27896653-27896675 AGCCCAGGCCCAGGAGCAGCCGG - Intergenic
1164518878 19:28961581-28961603 GGGCCTGGCTCAACATTAGCAGG + Intergenic
1165093183 19:33397086-33397108 AGGGCAGGCCCAGCAGCTGCAGG - Intronic
1165384371 19:35501846-35501868 AGGCCAGGCCCAGCAGGAGCAGG + Intronic
1165899788 19:39163807-39163829 GGACAAGGCCCAGCAGCACCCGG - Intronic
1165907803 19:39204218-39204240 GGGCCAGGGCCAGCAGCAGCGGG + Exonic
1166088117 19:40490203-40490225 AGACCAGCCCCAGCGTCAGCCGG - Exonic
1166294513 19:41882607-41882629 GGCCCAGGCACAGCAACAGCTGG + Intergenic
1166359632 19:42247766-42247788 GGGCCAGTCCTAGGAGCAGCTGG + Exonic
1166691228 19:44822271-44822293 GGGCCAAGCCCAGCACCCTCGGG - Intergenic
1167096993 19:47379880-47379902 GCACCAGGCCCAGCAGCAGCTGG + Exonic
1167638422 19:50667885-50667907 CGGCCAGGGCCAGCCCCAGCGGG + Exonic
1168254738 19:55159193-55159215 GGGCCTGACCCAGCCTCTGCAGG - Exonic
926107826 2:10163370-10163392 GGGCCAAGCCCACCACCTGCAGG + Intronic
927507981 2:23626923-23626945 GGGCCAGGCCCAACCTCCTCAGG + Intronic
927826621 2:26313796-26313818 GAGCCAGGCCCAGGCTCTGCAGG + Exonic
927847930 2:26480866-26480888 CAGCCAGGCCCAGCAGGAGCCGG + Exonic
932479108 2:72028022-72028044 GAGCCAGGCCCAGCCACACCGGG + Intergenic
935698457 2:105789847-105789869 TGGCCAGCACCAGCATCACCTGG - Intronic
936263664 2:110982814-110982836 GGGCCAGGGCCAGCTTCATGGGG + Intronic
936339823 2:111621237-111621259 GGGCCAGCCCCATCATCTGCAGG - Intergenic
937017137 2:118616611-118616633 GGGCCAGGCTCCGCCCCAGCTGG + Intergenic
937297732 2:120819909-120819931 AGGCCAGACCCAGCCTGAGCTGG + Intronic
937905521 2:127051057-127051079 AGGCCTGGACCAGCACCAGCAGG + Intronic
937929898 2:127195918-127195940 GGGCCGGGCCCAGCATCCTGGGG - Intronic
938296554 2:130182639-130182661 GGGCCACGTTCAGCTTCAGCAGG - Exonic
938296619 2:130182884-130182906 GGTCTAGGCCCAGCACCTGCAGG + Intronic
938313163 2:130307910-130307932 TGGCCAAGCCCAGCCTCAGTGGG - Intergenic
938460128 2:131491741-131491763 GGTCTAGGCCCAGCACCTGCAGG - Intronic
938460194 2:131491990-131492012 GGGCCACGTTCAGCTTCAGCAGG + Exonic
938946475 2:136216878-136216900 GGGCCAGCCTCAGCATTAGCTGG - Intergenic
940038123 2:149330783-149330805 TGGCCAGGCCCCGCCTAAGCCGG - Intronic
944416028 2:199480723-199480745 GAGCCAGGCCCAGTAGCAGTGGG + Intergenic
944499374 2:200342466-200342488 AAGGCAGGCCCAGCATCAGACGG - Intronic
944855645 2:203764494-203764516 GGGCCAGGCCCAGGAGTACCAGG - Intergenic
945822014 2:214675717-214675739 GGAGCAGGTCCAGCAACAGCAGG + Intergenic
947826007 2:233106490-233106512 TGGCCAAGCCCAACATCAGTGGG + Intronic
948383318 2:237566603-237566625 GGGCCAGGCCCAGCATCAGCAGG - Exonic
948978340 2:241478474-241478496 GGTCCTGGCACAGCATCTGCTGG - Intronic
948982482 2:241501430-241501452 GAGCCGGGCACAGCACCAGCAGG + Intronic
1169864424 20:10184639-10184661 TGGCCAAGCCCAGCATCAGCAGG - Intergenic
1171481439 20:25458478-25458500 GGCCCAGGCCCAGCACTTGCAGG - Exonic
1172310348 20:33913296-33913318 GAGCCAGGTTCAGCAGCAGCAGG - Intergenic
1172510544 20:35497937-35497959 GGCCCAGGCCCAGGCCCAGCTGG + Exonic
1174174261 20:48635197-48635219 GGACCAGGCCCAGGGTGAGCGGG - Intronic
1174452029 20:50626315-50626337 AGCCCAGGCCCAGCATCCTCTGG + Intronic
1174540699 20:51286971-51286993 AGGCCAAGCCCAGCATCAATGGG - Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175816595 20:61886261-61886283 TGGCCATACCCAGCATCGGCTGG - Intronic
1175861232 20:62151433-62151455 GGGCCAAGCCCAGCACCCACAGG - Intronic
1175865100 20:62171386-62171408 GGGCCGGTTCCAGCAACAGCTGG - Intronic
1175891227 20:62316896-62316918 TGGCCAGGCCCTGCAGCAGGCGG - Exonic
1175931523 20:62496017-62496039 GGGCCAGACTCAGGAGCAGCCGG - Intergenic
1176101148 20:63365116-63365138 GGGCGAGGCCCAGCTGCAGGAGG - Intronic
1178247220 21:30965148-30965170 TGGCCAAGCCCAGCATCACTGGG - Intergenic
1178263867 21:31124526-31124548 GGGCCAGGCCGGCCATGAGCAGG - Exonic
1179023639 21:37660766-37660788 GGGCCAGGCACTGCACCAGAGGG + Intronic
1179717775 21:43298561-43298583 GGGCCAGGCCGGGCTTCAGGAGG + Intergenic
1179949080 21:44699615-44699637 GGGCCAGGCGCAGCAGGGGCTGG - Intronic
1180007501 21:45029633-45029655 TGGCCAGGCCCAGGATCTGGAGG + Intergenic
1180024197 21:45149370-45149392 GGGACAGGCCCAGAGACAGCAGG - Intronic
1180609137 22:17084746-17084768 GGGCCAGGCCCAGGAGCAGCGGG + Intergenic
1181392082 22:22590661-22590683 TGGCCAGGCCCAGCCTGAGGGGG + Intergenic
1181401425 22:22652225-22652247 GCGCCAGCCCCAGCCCCAGCAGG - Intergenic
1181432147 22:22888128-22888150 TGGCCAGACCCAGCAGCAGCAGG - Exonic
1181542321 22:23580094-23580116 CGGCCAGACCCAGCAGCAGCAGG + Exonic
1181550780 22:23638094-23638116 GGGCCAGGGCCAGAAGCAGAGGG + Intergenic
1181556957 22:23676711-23676733 AGGCCAGGCCCACCTGCAGCAGG - Intergenic
1181697414 22:24600825-24600847 AGGCCAGGCCCACCTGCAGCAGG + Intronic
1182473116 22:30560788-30560810 GGTTCAGGCCCAGCAGCAGGGGG + Intronic
1182476748 22:30580714-30580736 GGGCCAGGCCTCGCACCACCAGG + Intronic
1183106747 22:35620453-35620475 GTGCCAGGCCCAGCCTCAGAAGG + Intronic
1183184841 22:36285905-36285927 GCGCCAGGCCCAGCAGGAGCGGG - Exonic
1183341136 22:37282498-37282520 GGGCCAGCCCGAACAGCAGCTGG + Exonic
1183829199 22:40409061-40409083 GGACCCAGCCCAGCATCAGGGGG + Intronic
1184086693 22:42270107-42270129 GGGCCAGGCCTGGCATCAGAGGG - Intronic
1184116685 22:42426566-42426588 GGGCCAGGCCCCACCTGAGCCGG - Intronic
1184409903 22:44320396-44320418 GGGCCAGGCCGTGGATCAGGGGG + Intergenic
1184648507 22:45908890-45908912 GGGCCAGACCCTGCCTGAGCGGG + Intergenic
1184651998 22:45923716-45923738 GGGGTAGGCCCAGCAACAGTAGG + Intronic
1184785160 22:46668134-46668156 GGGCGACGTCCAGCACCAGCTGG - Exonic
1184837861 22:47034620-47034642 GAGCCAGGCCCAGAGACAGCCGG - Intronic
1184889643 22:47371918-47371940 GGGCCAAGCCCCGCATCCCCTGG - Intergenic
1185042485 22:48512208-48512230 GGGCCAGCCCCACTGTCAGCAGG - Intronic
949919096 3:8987473-8987495 GGGCCGGCCCCAGCATCTCCAGG - Intronic
950487152 3:13280639-13280661 GGTCCGGGCCCAGCAGCAGCGGG + Intergenic
950672729 3:14536898-14536920 TGGCCAGGGCGAGCATCAGGAGG - Intronic
950907611 3:16553310-16553332 CAGCCAGGCACAGCAGCAGCGGG + Intergenic
952930923 3:38360558-38360580 GGATCAGGCTCAGCCTCAGCTGG + Intronic
952964205 3:38611003-38611025 GTCACAGGCCCAGCAGCAGCAGG - Intronic
953023948 3:39134214-39134236 GCGCCAGCTCCAGCATCACCTGG - Exonic
953344027 3:42160167-42160189 GCTCCTGGCCCAGCATCACCCGG - Intronic
953626829 3:44578907-44578929 GGCCCAGGGCCACCCTCAGCTGG + Intronic
954421210 3:50419990-50420012 GGGCCAGGCCCTGCTTCCCCAGG + Intronic
955893847 3:63678038-63678060 GGGCCAGGCCTGGCATAAGGAGG - Intronic
955949222 3:64225320-64225342 GGGTCTGGCTCAGGATCAGCTGG - Exonic
960146993 3:114214053-114214075 GAGCCAGCACCAGCTTCAGCAGG + Intergenic
961002259 3:123381965-123381987 GGGCCTTGCCCACCACCAGCTGG - Intronic
961484541 3:127207828-127207850 GGGCCAGGCAGAGCATCACTGGG - Intergenic
962927207 3:140005815-140005837 GGGCCAATGCCATCATCAGCTGG + Intronic
963422123 3:145073533-145073555 GGCTCAGGCCCAGCATCCCCAGG - Intergenic
968759391 4:2434192-2434214 GGGAAAGGCCCAGCGGCAGCAGG + Intronic
968810615 4:2798118-2798140 AGACCAGGCCCAGAAGCAGCTGG - Intronic
968916196 4:3497992-3498014 GGGACAGGCCCAGTATCTGCTGG + Intronic
969312897 4:6364371-6364393 GGGCCAGGGCCAGCTCCTGCAGG + Intronic
969672739 4:8598626-8598648 GGGCCCGTCCCAGCACTAGCCGG + Intronic
970753332 4:19393498-19393520 TGGCCAAGCTCAACATCAGCAGG + Intergenic
971453446 4:26821660-26821682 GGGCCAGGACCTGCATTCGCAGG - Intergenic
974093357 4:57335480-57335502 TGGCCAAGCCCAACATCAGTGGG + Intergenic
978885565 4:113762346-113762368 GGGCAAAACCCAGCCTCAGCAGG + Intergenic
979393916 4:120162739-120162761 GGACCAAGCCCAGTATCAGATGG - Intergenic
981669899 4:147275085-147275107 GGGCCAGCCCCAGTAGCTGCAGG - Intergenic
985164621 4:187079337-187079359 GTACCAGGCACAGCAGCAGCAGG + Intergenic
985555666 5:556800-556822 GGGCCCGGGGCAGCATCAGCAGG + Intergenic
985579691 5:690113-690135 GGGTCAGGCCCAGCCACATCTGG - Intronic
985594537 5:782172-782194 GGGTCAGGCCCAGCCACATCTGG - Intergenic
986012419 5:3728200-3728222 GGGCCAGGCACACCATGAACAGG - Intergenic
986350072 5:6868981-6869003 GGTCCAGGCTCAGCATCACAGGG + Intergenic
986732471 5:10645382-10645404 TGGCCAGGCCCAGGACTAGCAGG - Intronic
991417699 5:66408783-66408805 GGGTCAGGCCCTGCAGCAGGCGG + Intergenic
994511447 5:100709127-100709149 GGGCCAGTCCCAACATCACAGGG - Intergenic
995170668 5:109107871-109107893 CTGCCAGGCCCAGCATCTGCAGG + Intronic
995257702 5:110066016-110066038 TGGCAAGGCCCAGCAGCAGTAGG + Intergenic
997796216 5:136814004-136814026 GGTCCTGGATCAGCATCAGCTGG + Intergenic
997889113 5:137659377-137659399 TGGCCAGGGCCATCATCTGCTGG + Intronic
998647321 5:144076553-144076575 GGCCCAGTCCCAGCATCCCCAGG + Intergenic
999346128 5:150820913-150820935 GGGCCAGGCCCAGGGTCTCCAGG - Intergenic
999715321 5:154355508-154355530 GGGCCAGGGCCAGGTCCAGCGGG + Intronic
999831586 5:155325353-155325375 TGGCCAGCCCCCGCATCATCTGG - Intergenic
1001964296 5:175899737-175899759 GAGCCAGCCCCAGCCTGAGCCGG - Intergenic
1002297716 5:178240584-178240606 GGGCCAGGCCCCGGAGCTGCGGG + Intronic
1002334170 5:178466634-178466656 GGGCCATCCCCCGCAGCAGCAGG - Intronic
1002563705 5:180098750-180098772 GGGCCAGACACTGAATCAGCCGG + Intergenic
1002915385 6:1524435-1524457 GCGCCAGGCACCGCATCTGCCGG - Intergenic
1004289189 6:14350940-14350962 GGGCCAGGGCCAGTACCAGCAGG + Intergenic
1004614859 6:17280707-17280729 GGACCCGGCGCAGCACCAGCCGG - Intergenic
1006116572 6:31779035-31779057 GCGGCAGGCCCAGCGTCTGCGGG - Exonic
1006121694 6:31810775-31810797 GAGCCACGTCCAGCAGCAGCAGG + Exonic
1006122720 6:31816926-31816948 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006124583 6:31829120-31829142 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006342852 6:33456091-33456113 GGGCCAGGGCCAACATCTGGGGG + Exonic
1006614966 6:35319951-35319973 GCAGCAGGCCCAGCAGCAGCTGG + Exonic
1007372134 6:41432740-41432762 CTTCCAGGCCCAGCAACAGCTGG + Intergenic
1014109254 6:117602254-117602276 GGTCCATGCCCAGCAGCAGCCGG - Exonic
1015265798 6:131291044-131291066 TGGCCAAGCCCAACATCAACAGG - Intergenic
1018949918 6:168372329-168372351 AGGTCAGGCCCAGCAGCACCAGG + Intergenic
1019318838 7:405722-405744 GGGCCAGGCTCGGCCTCAGAGGG - Intergenic
1019409804 7:901536-901558 GCACCCGGCCCAGCACCAGCTGG + Intronic
1019485163 7:1285929-1285951 GGGGCAGGGCCAGGCTCAGCGGG - Intergenic
1019526734 7:1483745-1483767 GAGGCGGGCCCAGCGTCAGCAGG + Exonic
1020055860 7:5117264-5117286 GGGCCAGGCCCAGGATCAGTAGG - Intergenic
1020142744 7:5621546-5621568 GGGCCAGGCCCTGCTTCAGGAGG + Intronic
1020236643 7:6361037-6361059 GGGCCAGGCCCAGGCCCTGCTGG + Intergenic
1022498312 7:30866831-30866853 GGCCCAGGCTCATCAGCAGCTGG - Intronic
1023987257 7:45104080-45104102 GGGCCAGGCCCTGGCTCACCTGG + Exonic
1027250539 7:76396037-76396059 GGGCCATGCCCAGGGTTAGCAGG + Intronic
1027269496 7:76512065-76512087 GGGCAAGGCCCAGGAGGAGCAGG + Intronic
1027320207 7:77005959-77005981 GGGCAAGGCCCAGGAGGAGCGGG + Intergenic
1027535593 7:79396348-79396370 GGATCAGTCCCAGAATCAGCTGG + Intronic
1029419927 7:100467180-100467202 GGGACAGGCACAGCGTCAACGGG + Intronic
1032453152 7:132051992-132052014 GTCCCAGGCCCAGGAGCAGCAGG + Intergenic
1032830961 7:135625157-135625179 GAGCCAGGGCCAGCATCTGAAGG - Exonic
1033280061 7:139999735-139999757 GGGCAAGGGCCAGCATCACTTGG + Intronic
1033367605 7:140683615-140683637 CGGCCAGGCCCCTCTTCAGCTGG - Intronic
1034438726 7:151076045-151076067 GGGCCAGGCAGAGCAGCTGCAGG - Exonic
1034472842 7:151264791-151264813 GGGCCAGGCCCGGGACTAGCTGG + Intronic
1034509333 7:151520850-151520872 GGGCCATGCCCGGCCTCTGCAGG - Intergenic
1034947143 7:155269826-155269848 GGGAGAGGCCGAGCAGCAGCAGG + Intergenic
1034991112 7:155548702-155548724 GGGCCCAGCCCAGCATCTCCAGG + Intergenic
1035070677 7:156143275-156143297 CGGCCAGGCCCAGCATGCTCGGG - Intergenic
1035282662 7:157787445-157787467 GACCCAGGCACAGCAACAGCTGG - Intronic
1035382355 7:158447984-158448006 TGGCCTGGCCCAGCATCCTCGGG - Intronic
1035709225 8:1699768-1699790 GGGCCCTGCACAGCATCTGCTGG + Intronic
1035877128 8:3203252-3203274 GGGCCATGTCCAGAATGAGCTGG - Intronic
1036581674 8:10081136-10081158 GGGCCATCCACAGCAACAGCAGG + Intronic
1036651958 8:10649937-10649959 GGGAGAGGCCCAGCAACTGCAGG - Intronic
1037236067 8:16720674-16720696 GGACCAGGTCTAGCATGAGCCGG - Intergenic
1037416029 8:18650666-18650688 GGGCCAGGCACAGGAGAAGCTGG + Intronic
1037700651 8:21271275-21271297 TGGCCAGGCCCAGCCTTAGAGGG + Intergenic
1038419247 8:27421833-27421855 GAGCAAAGCGCAGCATCAGCAGG + Intronic
1047239386 8:123072641-123072663 GGCCTAGGTCCAGCACCAGCAGG - Intronic
1047761479 8:127957891-127957913 GGGCAAGGCCGAGAAACAGCGGG + Intergenic
1048051536 8:130821793-130821815 GTGCCTGGCCCAGTATAAGCTGG - Intronic
1049103692 8:140597968-140597990 GGGCCCCGCCAAGCATCTGCTGG - Intronic
1049403799 8:142442793-142442815 TGGCCCTGCCCAGCATCAGTGGG + Intergenic
1049411835 8:142477034-142477056 GGGCCAGACCCCGCAGCAGGAGG - Intronic
1049655370 8:143794738-143794760 TGGGCAGCCCCAGCAGCAGCAGG + Intronic
1049660520 8:143817808-143817830 GGGCCAGCCCCAGCCTCAGGTGG + Intronic
1049763553 8:144342359-144342381 GGGCCCAGCCCAGCTTGAGCTGG + Intergenic
1049923454 9:386757-386779 GTCCCTGGACCAGCATCAGCTGG - Intronic
1051328198 9:15996294-15996316 CGGCCAGGCGCACCAACAGCAGG - Intronic
1051909854 9:22140896-22140918 CGGCCAAGCCCAACATCAGGAGG - Intergenic
1052892901 9:33720231-33720253 GGGCCAGGCCAGGCTCCAGCAGG + Intergenic
1053425417 9:38006891-38006913 GGGCCAGGGCCACCTTCAGTAGG - Intronic
1056329713 9:85511319-85511341 GGCCCTGGCCCAGCCCCAGCTGG + Intergenic
1056797744 9:89670261-89670283 GGCCCAGGTCCAGCCTCTGCTGG - Intergenic
1057091597 9:92263024-92263046 GGGCCGTGGCCAGCACCAGCAGG + Exonic
1057206396 9:93175570-93175592 GGGGCTGGCCCTGCTTCAGCAGG + Intergenic
1059433350 9:114262769-114262791 GGGCAAGGCCAAGGCTCAGCTGG - Intronic
1060231240 9:121827028-121827050 GGGCCTTGCCCAGCACCTGCAGG - Intronic
1060521922 9:124298862-124298884 GGGCAGGGCCCAGCATGATCAGG + Intronic
1061680912 9:132242072-132242094 CGGCCAGCCCCAGCAGCAGCAGG - Exonic
1061952161 9:133942732-133942754 GGGCCAGGCACAGCAGTTGCTGG - Intronic
1062005243 9:134235563-134235585 GGGCCAGGCGCAGACTCGGCCGG - Intergenic
1062021729 9:134322762-134322784 GGGCCAGACCCAGGAGCAGAGGG + Intronic
1062068950 9:134544955-134544977 GAGCCAGGCCCAGCAACAGAGGG + Intergenic
1062245033 9:135561813-135561835 GGGCCACGCCCAGGGTGAGCAGG - Exonic
1062245811 9:135565528-135565550 AGGACACGCCCAGCCTCAGCTGG + Intronic
1062288558 9:135784567-135784589 TGTCCAGGCCCAGCAGCAGCCGG - Exonic
1062376361 9:136263621-136263643 GGCCCAGGCCAAGCTGCAGCAGG - Intergenic
1062562762 9:137149106-137149128 GGGCCCTGCCCAGCCTCACCTGG - Exonic
1062577074 9:137213855-137213877 GGGCGATGACCAGCATGAGCTGG + Exonic
1062582609 9:137235154-137235176 GGGCAGGGCCCAGCATCGGTGGG - Intronic
1185508251 X:644390-644412 GGTCCAGGCTCAGCTGCAGCTGG + Exonic
1185557327 X:1031725-1031747 GGGCCTGGTCCACCAGCAGCAGG + Intergenic
1186076114 X:5881081-5881103 GGCCAAGGACCAGAATCAGCTGG - Intronic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1188451022 X:30308463-30308485 GGGCCAGCTCAAGCATGAGCAGG + Exonic
1190216271 X:48481493-48481515 GTGCCAAGCCCAGGAGCAGCCGG + Exonic
1195037907 X:100986940-100986962 GGGCCAAGGGCTGCATCAGCTGG - Intronic
1195210777 X:102651293-102651315 GGGCCAGGACGAGCCCCAGCCGG - Intergenic
1200039625 X:153355794-153355816 GGGCCAGCCCCAGCTCCAGGGGG + Intronic
1200229156 X:154435515-154435537 GGGCGTGGCCCAGCTTCAGGTGG + Intronic
1201938769 Y:19435741-19435763 GAGCCAGGCCCTTCATCTGCAGG - Intergenic
1202273929 Y:23096546-23096568 GAGCCAGGCACAGTAGCAGCGGG + Intergenic
1202292097 Y:23324131-23324153 GAGCCAGGCACAGTAGCAGCGGG - Intergenic
1202426925 Y:24730291-24730313 GAGCCAGGCACAGTAGCAGCGGG + Intergenic
1202443866 Y:24939803-24939825 GAGCCAGGCACAGTAGCAGCGGG - Intergenic