ID: 948383404

View in Genome Browser
Species Human (GRCh38)
Location 2:237566966-237566988
Sequence GACCATGGGCACGTGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948383404_948383411 23 Left 948383404 2:237566966-237566988 CCTGGGGACACGTGCCCATGGTC 0: 1
1: 0
2: 0
3: 18
4: 327
Right 948383411 2:237567012-237567034 CCCCTGACATCAATCCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948383404 Original CRISPR GACCATGGGCACGTGTCCCC AGG (reversed) Intronic
900757580 1:4447442-4447464 CACCTTGGGCACATGTCCTCAGG + Intergenic
900891411 1:5452227-5452249 CACCTTGGGCACCTGTTCCCAGG - Intergenic
902264790 1:15255585-15255607 GACCATGTGTGAGTGTCCCCAGG - Intronic
903653164 1:24933145-24933167 GACAAGGGGCAGGTGTGCCCTGG + Intronic
906095725 1:43222722-43222744 GAGCATGGGGACCTGTCCCAGGG - Intronic
906377323 1:45305529-45305551 CACCTTGGGCACATGTCGCCAGG + Intronic
906414578 1:45610851-45610873 GACTAAAGGCACATGTCCCCAGG + Intronic
906701898 1:47865549-47865571 TAGCATGGGCACTTGTCCCAGGG + Intronic
909700738 1:78519692-78519714 GGCCATGGGCACTTGTTCACAGG - Intronic
912620443 1:111151076-111151098 TACCTTGGGCACGTGTTCTCAGG - Intronic
912629934 1:111238205-111238227 CACCTTGGGCACATGTCCTCAGG + Intronic
916802014 1:168224824-168224846 GACCTTGGGCACATGTCGTCAGG + Intergenic
917864631 1:179181916-179181938 GACTATAGTCACGTGTCACCAGG + Intronic
919481870 1:198099941-198099963 GAGCAAGAGCATGTGTCCCCAGG - Intergenic
919701770 1:200638592-200638614 GACCATAGGCACATGCCACCAGG + Intronic
920907200 1:210182450-210182472 GACTATAGGCACATGTCACCAGG - Intergenic
923166966 1:231374653-231374675 GACTATAAGCACGTGTCACCAGG + Intronic
923380772 1:233415774-233415796 GACGTTGGGCACGTGTTCTCAGG - Intergenic
1063301511 10:4853539-4853561 CACAATGGGCACATGTCCTCAGG - Intergenic
1063383077 10:5598725-5598747 GAACATGGGCACAGTTCCCCAGG - Intergenic
1064637132 10:17379766-17379788 CACCTTGGGCACGTGTCATCAGG + Intronic
1064722254 10:18241204-18241226 CACCTTGGGCACATGTCACCAGG + Intronic
1066126306 10:32346532-32346554 GACCCTGGCCACTTGTACCCGGG - Intronic
1066242463 10:33551592-33551614 CACCTTGGGCACGTGTCATCAGG + Intergenic
1067420382 10:46140283-46140305 TACCTTGGGCACGTGTCATCAGG - Intergenic
1067425639 10:46209236-46209258 TACCTTGGGCACGTGTCATCAGG + Intergenic
1067505726 10:46846766-46846788 TACCTTGGGCACGTGTCATCAGG - Intergenic
1069048415 10:63766713-63766735 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1069953961 10:72038403-72038425 TACCTTGGGCATGTGTCCTCAGG + Intergenic
1070759776 10:79016825-79016847 GGCCATGGGGCCATGTCCCCTGG + Intergenic
1070976007 10:80606092-80606114 GGCCATGGGCACCCGTCCCATGG - Intronic
1071829109 10:89354364-89354386 TACCTTGGGCACATGTCCTCAGG + Intronic
1071898572 10:90092589-90092611 CACCTTGGGCACATGTCCTCAGG + Intergenic
1073905713 10:108276968-108276990 CACCTTGGGCACCTGTCCTCAGG - Intergenic
1074041472 10:109793595-109793617 GACCATGGGGAAATGTCTCCAGG - Intergenic
1075132704 10:119754171-119754193 GACCCTGGCCAGGAGTCCCCTGG - Intronic
1075991220 10:126840448-126840470 CACCGTGGGCACATGTCGCCAGG + Intergenic
1076551373 10:131280080-131280102 CACCCTGGGCACATGTCACCAGG - Intronic
1077038151 11:505135-505157 CACCTTGGGCACATGTTCCCAGG + Intronic
1077335429 11:2001440-2001462 GACCATGGCCCCGTATCACCTGG - Intergenic
1078403295 11:11046266-11046288 CACCTTGGGCACATGTTCCCAGG - Intergenic
1079483952 11:20914234-20914256 CACCTTGGGCACATGTCCTCAGG - Intronic
1081328757 11:41778582-41778604 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1083549583 11:63576481-63576503 GACTATAGGCACGTGTCACCAGG - Intronic
1083691998 11:64415063-64415085 GACCAGGTGCACGAGGCCCCTGG + Intergenic
1086287720 11:85268488-85268510 CACCTTGGGCACATGTCCTCAGG + Intronic
1088594498 11:111430170-111430192 AACCTTGGGCACGTGTCGTCAGG - Intronic
1202818412 11_KI270721v1_random:56622-56644 GACCATGGCCCCGTATCACCTGG - Intergenic
1092499528 12:9031653-9031675 CACCTTGGGCACATGTTCCCAGG - Intergenic
1092613754 12:10197742-10197764 CACCTTGGGCACATGTCCTCAGG + Intergenic
1092645764 12:10570282-10570304 GACCTTGGGCACATGTTCTCAGG + Intergenic
1093262547 12:16957153-16957175 GACTATAGGCACGTGCCACCAGG + Intergenic
1095871384 12:47031907-47031929 CACCTTGGGCACCTGTCACCTGG - Intergenic
1096367846 12:51043839-51043861 CACCTTGGGCACGTGTCATCAGG - Intergenic
1097049233 12:56211191-56211213 GACTATAGGCACGTGCCACCAGG - Intronic
1097573038 12:61356665-61356687 GACCCTGGGGACATGGCCCCAGG + Intergenic
1098535937 12:71593585-71593607 CACCTTGGGCACGTGTCATCAGG + Intergenic
1099545172 12:83970357-83970379 CACCTTGGGCACATATCCCCAGG - Intergenic
1101041766 12:100762594-100762616 GAAGATGTGCACTTGTCCCCAGG - Intronic
1101774906 12:107784913-107784935 GTCCATTGGCTTGTGTCCCCTGG + Intergenic
1101915391 12:108891989-108892011 GACAAGGGTCATGTGTCCCCAGG - Intronic
1104453666 12:128891892-128891914 CACCTTGGGCACGTGTCATCAGG - Intronic
1104852824 12:131886005-131886027 CACCTTGGGCATGTGTTCCCGGG - Intergenic
1104963489 12:132498929-132498951 GAGCATGGGCAGGTGGCCACGGG - Intronic
1105345191 13:19564979-19565001 GGCCCTGGGGCCGTGTCCCCCGG - Intergenic
1105832214 13:24173213-24173235 GACTATAGGCATGTGTCACCAGG + Intronic
1106119824 13:26850950-26850972 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1106342611 13:28845089-28845111 GACTATAGGCAAGTGTCACCAGG + Intronic
1106439209 13:29750662-29750684 CACCTTGGGCACGTGTCGTCAGG - Intergenic
1106977434 13:35237117-35237139 GACTATAGGCACATGTCACCAGG - Intronic
1109380974 13:61558904-61558926 GACCCTGGGCACATGTTCTCAGG - Intergenic
1109828447 13:67754688-67754710 AACCTTGGGCACATGTCCTCAGG - Intergenic
1111210543 13:85073086-85073108 GACCTTGGGCACATGTCATCAGG - Intergenic
1112516488 13:100057911-100057933 GACCAAAGGCACGTGCCACCAGG + Intergenic
1112576045 13:100637591-100637613 GATCATGGGCACGGGCCCGCCGG - Exonic
1114229461 14:20767498-20767520 CACCTTGGGCACATGTCCTCAGG + Intergenic
1114275409 14:21139029-21139051 GACTATAGGCACGTGCCACCAGG - Intergenic
1114520998 14:23335896-23335918 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114521950 14:23345119-23345141 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114635378 14:24184174-24184196 GACCATAGCCAGGTGTTCCCGGG - Intronic
1117579683 14:57139650-57139672 GAACATGGGCACCTGCCCCCAGG + Intergenic
1118198013 14:63646144-63646166 CACCTTGGGCACATGTCCTCAGG + Intergenic
1120425097 14:84337504-84337526 AACCTTGGGCACATGTTCCCAGG + Intergenic
1120694866 14:87633332-87633354 CACCTTGGGCACATGTCCTCAGG - Intergenic
1122371583 14:101231954-101231976 GACCAGGGCCAGGTGTCTCCTGG - Intergenic
1123669743 15:22643841-22643863 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1124525716 15:30450257-30450279 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1124772939 15:32557428-32557450 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1125218131 15:37302480-37302502 GACCATAGGCATGTGCCACCAGG - Intergenic
1126114086 15:45193279-45193301 CACCTTGGGCACCTGTCCTCAGG - Intronic
1126644953 15:50866771-50866793 CACCTTGGGCACATGTTCCCAGG - Intergenic
1127665019 15:61137500-61137522 GGCCATGGGCACGTGCTGCCAGG - Intronic
1129021780 15:72526285-72526307 GACCATGGGCACCTCCCTCCAGG - Intronic
1131559388 15:93426205-93426227 CACCATGAGCACGTGTCTCCAGG - Intergenic
1132388124 15:101416549-101416571 GACCATGGGAAAATGTCTCCAGG + Intronic
1132575025 16:660275-660297 GCCCTTGGGCGCCTGTCCCCTGG + Intronic
1132930775 16:2458126-2458148 GGCCATGGTCACATGGCCCCAGG - Exonic
1133105690 16:3507420-3507442 GACTACAGGCACGTGTCACCAGG - Intronic
1133576825 16:7099602-7099624 CACCTTGGGCACGTGTCCTCAGG - Intronic
1134071097 16:11260242-11260264 GACCATGGGAAAGTGTCCCAAGG - Intronic
1134198868 16:12181267-12181289 CACCTTGGGCACATGTCCTCGGG - Intronic
1135214128 16:20549680-20549702 CACCTTGGGCACGTGTTCTCAGG - Intronic
1135614561 16:23899773-23899795 GACCGTAGGCACGTGCCACCAGG + Intronic
1135645096 16:24154851-24154873 GACCATGGTAACTTGTCCCATGG + Exonic
1137416741 16:48289250-48289272 CACCTTGGGCACGTGTCGTCAGG - Intronic
1138296640 16:55891405-55891427 CACCTTGGGCACATGTCACCAGG - Intronic
1138458087 16:57132745-57132767 TAGCATGGACACTTGTCCCCAGG + Intronic
1140056961 16:71533902-71533924 GACTATAGGCACGTGCCACCAGG - Intronic
1140264365 16:73407834-73407856 GACCATTTGCACGATTCCCCAGG - Intergenic
1141810305 16:86371489-86371511 GACCCGGGGCACGTGGCACCCGG + Intergenic
1141855198 16:86676592-86676614 GGCCTTGGGCACATGTCACCAGG - Intergenic
1142102915 16:88285119-88285141 GGTCATGGGCACGTGTGCCTTGG - Intergenic
1142442860 16:90112062-90112084 GACCTTGGGCACATGTTCTCAGG - Intergenic
1142464841 17:129329-129351 GACCTTGGGCACATGTTCTCAGG + Intergenic
1142592463 17:1012345-1012367 GGGAAAGGGCACGTGTCCCCCGG - Intronic
1143803690 17:9407541-9407563 CACCTTGGGCACATGTTCCCAGG - Intronic
1143924213 17:10355577-10355599 GAACATGGGCACCTCTCCACCGG + Intronic
1144179162 17:12735777-12735799 GAGCATGCGCCCGTGTCCCTCGG - Intronic
1144559202 17:16307831-16307853 GACTATAGGCACGTGCCACCGGG - Intronic
1144905698 17:18638554-18638576 AACCATGGGCGCCTGTCTCCTGG + Intronic
1145884354 17:28372016-28372038 GACCATGGGCGCGGGGCCGCGGG - Exonic
1145887128 17:28390033-28390055 CACCTTGGGCACGTGTTCTCAGG - Intronic
1147742024 17:42675261-42675283 GGCCAGGGACACCTGTCCCCAGG + Intronic
1147995270 17:44356618-44356640 GACCATGGACAGGGATCCCCAGG + Intronic
1148388159 17:47251341-47251363 CACCTTGGGCACGTGTCTTCAGG - Intergenic
1149418875 17:56489037-56489059 GACAGTGGGCACGTGACCTCTGG - Intronic
1149478845 17:56985593-56985615 GGCCATGGGCACTTGTCCGCAGG + Intronic
1150623052 17:66822809-66822831 GACATTGGGCAAATGTCCCCTGG + Intergenic
1151438060 17:74110549-74110571 GACCACAGGCACGTGCCACCAGG - Intergenic
1151477499 17:74352364-74352386 GAACATGGGCACATGTGCCCAGG + Intronic
1152067885 17:78121485-78121507 GACTCTGGGCACCTGCCCCCTGG - Intronic
1152310873 17:79549069-79549091 GACCAAGGTCCCTTGTCCCCAGG + Intergenic
1153526251 18:5997719-5997741 CACCTTGGGCACATGTCCTCAGG + Intronic
1156942074 18:42780118-42780140 CACCATGGGTACATGTCCTCAGG - Intronic
1157018124 18:43744207-43744229 TACCATGGGCACATGTTCTCAGG - Intergenic
1157909739 18:51604507-51604529 CACCATGGGCACATGTTCTCAGG - Intergenic
1157954755 18:52084508-52084530 CACCTTGGGCACGTGTCATCAGG + Intergenic
1158645946 18:59247208-59247230 CACCTTGGGCACGTGTCATCAGG + Intergenic
1159918460 18:74205950-74205972 CACCTTGGGCACATGTCCTCAGG + Intergenic
1160507125 18:79433507-79433529 GAGCACGGGCACGTGTGGCCCGG + Intronic
1160724295 19:610783-610805 GACCCTGGGCAAGTTTCCCAGGG + Intronic
1160924610 19:1537648-1537670 GACCACGGGCATGTGCCACCAGG - Intergenic
1161901099 19:7120320-7120342 CACCTTGGGCACCTGTCCTCAGG + Intronic
1163088327 19:14999491-14999513 GACCTTGGGCACATGTCATCAGG + Intronic
1163398744 19:17079097-17079119 AGCCATGGCCACGTGTCCCCTGG + Intronic
1163560770 19:18018096-18018118 GACCATAGGCACATGCCACCAGG - Intergenic
1165135183 19:33663425-33663447 GACCACAGGCACGAGTCACCAGG - Intronic
1165249734 19:34520217-34520239 CACCTTGTGCACGTGTCCTCAGG - Intergenic
1165257136 19:34584812-34584834 CACCTTGGGCACATGTCCTCAGG - Intergenic
1165368896 19:35389872-35389894 GACCTTGGGCACATGTTCTCAGG - Intergenic
1165684780 19:37810045-37810067 GACCATGGGCGCCTGCCACCAGG - Intronic
1166037594 19:40180403-40180425 GACCTTGGGCATGTGTTCCCAGG - Intergenic
1166515498 19:43443735-43443757 CACCTTGGGCACGTGTCATCAGG - Intergenic
1167115809 19:47488445-47488467 GCCCAAGGGCACTTGTCCCAAGG + Intronic
1168625937 19:57917892-57917914 CACCATGGGCACATGTCGTCAGG + Intergenic
925308136 2:2864744-2864766 CACCCTGGGCACGTGTCGTCGGG + Intergenic
925357638 2:3253358-3253380 CACCTTGGGCACATGTTCCCAGG + Intronic
926301884 2:11610849-11610871 GACCATGAGCCCGTGGCCGCAGG - Exonic
926979979 2:18558970-18558992 CACCTTGGGCACATGTCCTCAGG + Intronic
927006950 2:18861099-18861121 GACCATGGGCAAGTGTGCAGTGG + Intergenic
927908702 2:26881099-26881121 GACTATGGGCACGTCCTCCCAGG - Intronic
928682138 2:33713640-33713662 CACCTTGGGCACATGTCCTCAGG - Intergenic
928700817 2:33896735-33896757 GACTATAGGCATGTGTCACCAGG - Intergenic
928930162 2:36616125-36616147 CACCATGGGCACATGTTCTCAGG - Intronic
931416744 2:62088810-62088832 GACCTTGGGCACATGTTCTCAGG - Intronic
932812639 2:74837185-74837207 GACCTTGGGCAAGTTACCCCTGG - Intronic
933066832 2:77808234-77808256 CACCTTGGGCACATGTCCTCAGG + Intergenic
934932607 2:98440414-98440436 GACCATAGGCATGTGCCACCAGG + Intergenic
935808557 2:106772904-106772926 CACCTTGGGCACATGTCCTCAGG - Intergenic
936906705 2:117544584-117544606 GACTATGGGCACGTGCCACCAGG - Intergenic
939324866 2:140674686-140674708 CACCTTGGGCACGTGTTCTCAGG + Intronic
939436143 2:142180697-142180719 GTCCCTGGGCACAGGTCCCCGGG - Intergenic
945495345 2:210501250-210501272 GACAATGGGAAAATGTCCCCAGG - Intronic
946089847 2:217211295-217211317 CACCTTGGGCACGTGTTCTCAGG + Intergenic
946374461 2:219299718-219299740 GAGCATGTGCACATGTCCTCAGG - Exonic
946702208 2:222424824-222424846 AACCATGGGCAGGTGTTCGCCGG + Intronic
948383404 2:237566966-237566988 GACCATGGGCACGTGTCCCCAGG - Intronic
948930063 2:241126330-241126352 GCTGATGGGCACGTGTCCTCAGG + Exonic
1168761544 20:353350-353372 GGCCCTGGGCACCTGTCGCCTGG + Exonic
1170930637 20:20767147-20767169 CACCTTGGGCACATGTCCTCAGG - Intergenic
1171425359 20:25045361-25045383 GGCCATGGGCACCCGTCCCAGGG + Intronic
1172415112 20:34759155-34759177 GACCATGGGCACATGCCACTGGG + Intronic
1175058362 20:56218780-56218802 CACCTTGGGCACATGTCCTCTGG - Intergenic
1175154342 20:56959569-56959591 GGACATGGCCACGTGTCCCGTGG + Intergenic
1176095397 20:63341410-63341432 CACCTCGGGCACGTGTCCTCAGG + Intergenic
1176976355 21:15326585-15326607 GACCCTGGGGACATGGCCCCAGG - Intergenic
1177197957 21:17922853-17922875 CACCTTGGGCACGTGTCTTCAGG - Intronic
1177255876 21:18662300-18662322 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1179620030 21:42608071-42608093 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1179649473 21:42797837-42797859 CACCTTGGGCACGTGTCGTCAGG + Intergenic
1181595848 22:23913927-23913949 GACCATCTGCCCGTGTGCCCAGG - Intergenic
1181921054 22:26320789-26320811 AAACATTGGCAAGTGTCCCCTGG - Intronic
1182407283 22:30146355-30146377 GACTATAGGCACGCGCCCCCAGG - Intronic
1182782260 22:32877592-32877614 CACCATTGCCAAGTGTCCCCTGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184414120 22:44342261-44342283 GACCATGGGAACACCTCCCCCGG - Intergenic
949107776 3:221206-221228 CACCTTGGGCACGTGTTCTCAGG + Intronic
949530991 3:4954959-4954981 CACCTTGGGCACATGTCCTCTGG - Intergenic
949836685 3:8277855-8277877 CACCTTGGGCACGTGTCATCAGG + Intergenic
953501943 3:43444983-43445005 GACTATAGGCACCTGTCACCAGG - Intronic
953848267 3:46445858-46445880 GTACAGGGGCACATGTCCCCAGG + Intronic
954321346 3:49833966-49833988 GACCATGGGTGGGTGTCCCAAGG - Intronic
954587937 3:51753062-51753084 CACCTTGGGCACGTGTCATCAGG - Intergenic
955416358 3:58695712-58695734 CACCTTGGGCACATGTCCTCAGG - Intergenic
958037872 3:88191153-88191175 CACCTTGGGCACATGTCGCCAGG - Intergenic
958522768 3:95212447-95212469 CACCATGGGCACGTGTCATCAGG + Intergenic
960517396 3:118617371-118617393 GTCCTTGGGAACGTGTCCACTGG - Intergenic
960712790 3:120547545-120547567 CACCTTGGGCACATGTCCTCAGG - Intergenic
961406680 3:126684676-126684698 GACCATGGCAACTTGTTCCCTGG - Intergenic
962833255 3:139162525-139162547 CACCTTGGGCACGTGTCATCAGG - Intronic
963454050 3:145521620-145521642 CACCTTGGGCACGTGTCTTCAGG - Intergenic
963896336 3:150688874-150688896 CACCTTGGGCACATGTCACCAGG + Intronic
964155541 3:153580958-153580980 GATTATGGGCACGTGCCACCAGG - Intergenic
964590918 3:158361179-158361201 GACCCTGGGGACATGGCCCCAGG + Intronic
964735923 3:159917217-159917239 GTCCATGGGCTCATATCCCCTGG + Intergenic
965928567 3:174013849-174013871 GACCATAGGCATGTGCCACCAGG + Intronic
967755432 3:193163123-193163145 CACCTTGGGCACATGTTCCCAGG + Intergenic
967886938 3:194339837-194339859 CACCTTGGGCACATGTTCCCAGG - Exonic
968363132 3:198163022-198163044 GACCTTGGGCACATGTTCTCAGG - Intergenic
968890146 4:3364545-3364567 GTCCAGGGGCTCGTGGCCCCCGG + Intronic
969330379 4:6471127-6471149 GGCCCTGGGCACGGGTCCCGCGG - Intronic
969487067 4:7478297-7478319 GACCATGGGGAGGGGTCTCCTGG - Intronic
969495940 4:7526193-7526215 GTGGATGGGCACGTGACCCCTGG - Intronic
969682802 4:8652545-8652567 GACCGTGGGCCTGGGTCCCCAGG + Intergenic
970276108 4:14403033-14403055 CACCATGGGCACATGTTCTCAGG - Intergenic
971019798 4:22523149-22523171 CACCTTGGGCACGTGTCGTCAGG - Intergenic
974077677 4:57182485-57182507 GGCCCTGGGCATGTCTCCCCCGG - Intergenic
975632356 4:76416471-76416493 GACCATGGGAAAATGTCTCCAGG + Intronic
975707362 4:77124299-77124321 CACCTTGGGCTCATGTCCCCAGG + Intergenic
976011263 4:80492247-80492269 CACCTTGGGCACGTGTTCTCAGG + Intronic
976738172 4:88332082-88332104 CACCTTGGGCACGTGTTCTCAGG - Intergenic
977960234 4:103076588-103076610 GACCATGGGCCCACGTCCCGGGG + Exonic
978337434 4:107684822-107684844 GACCTTGGGCACATGTTCTCAGG + Intronic
980329800 4:131395892-131395914 CACCTTGGGCACATGTTCCCAGG + Intergenic
981523313 4:145687381-145687403 CACCTTGGGCACATGTCCTCAGG + Intronic
981636791 4:146890528-146890550 CACCATGGGCACGGGCTCCCAGG - Intronic
981927452 4:150155555-150155577 GACCATGGAAACGTGGCCTCAGG + Intronic
983863753 4:172738695-172738717 CACCTTGGGCACGTGTTCTCAGG - Intronic
984166108 4:176304805-176304827 CACCTTGGGCACGTGTCCTCAGG + Intergenic
984550880 4:181157273-181157295 GACTATAGGCACATGCCCCCAGG - Intergenic
984983525 4:185305109-185305131 GACTATTGTCACATGTCCCCTGG - Intronic
985809129 5:2070378-2070400 GACCATGGGAAAATGTCTCCAGG + Intergenic
986041285 5:3996444-3996466 GGCAATGGCCACGTGACCCCAGG + Intergenic
986418838 5:7556604-7556626 GACCAGGGGTCCCTGTCCCCAGG + Intronic
986502215 5:8412904-8412926 GACCTCGGGCACATGTCTCCAGG + Intergenic
987216626 5:15744095-15744117 GACAATGGGCAAATGTCTCCAGG - Intronic
989042864 5:37247627-37247649 AACCATGGCCACGTGTCTCCTGG - Exonic
989717209 5:44478368-44478390 CACCTTGGGCACATGTCACCAGG + Intergenic
990176133 5:53110246-53110268 CACCTTGGGCACATGTCCTCAGG - Intergenic
992583704 5:78209608-78209630 AACCATGGGCACATGTCATCAGG + Intronic
992663242 5:78982532-78982554 GACCCAGGGCACGTGGCCCTAGG - Intronic
992802163 5:80303480-80303502 CACCTTGGGCACATGTTCCCAGG - Intergenic
993471932 5:88316863-88316885 CACCTTGGGCACATGTCACCAGG + Intergenic
993965428 5:94354894-94354916 CACCTTGGGCACATGTTCCCAGG - Intronic
996628219 5:125596418-125596440 CACCTTGGGCACATGTCCTCAGG + Intergenic
997453885 5:134004150-134004172 GACCGTGGCCCCGAGTCCCCAGG - Intronic
997756738 5:136406660-136406682 CACCATGGGCACATGTTCTCAGG - Intergenic
998521625 5:142806228-142806250 GACCACGGGCATGTGCCACCAGG + Intronic
999956667 5:156710495-156710517 CACCTTGGGCACGTGTTCTCAGG - Intronic
1002700808 5:181123333-181123355 CACCTTGGGCACGTGTCGTCAGG - Intergenic
1002890638 6:1328361-1328383 GACCAAAGGCCCCTGTCCCCAGG - Intergenic
1003067165 6:2913590-2913612 GACCTTGGGCACCTGTTCTCAGG - Intergenic
1003068025 6:2919839-2919861 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003070451 6:2941483-2941505 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003195163 6:3907876-3907898 CACCTTGGGCACATGTCCTCAGG + Intergenic
1003195839 6:3913802-3913824 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1004351139 6:14891475-14891497 AACCACAGGCACGTGTCACCAGG + Intergenic
1004497583 6:16179527-16179549 GACCATAGGCATGTGTCACCAGG - Intergenic
1006240348 6:32672657-32672679 GACCATGGGAAAATGTCTCCAGG + Intergenic
1007169707 6:39853899-39853921 GACAATGGGCAGGGGACCCCAGG + Intronic
1007240499 6:40421331-40421353 TACCTTGGGCACGTGTCTCCAGG - Intronic
1010383289 6:75248611-75248633 CACCTTGGGCACATGTTCCCAGG + Intronic
1010533227 6:76992174-76992196 GTCCATGGGCACATGTCCAAGGG - Intergenic
1012830752 6:104201317-104201339 GACCATGGGAAAATGTCTCCAGG + Intergenic
1014576717 6:123082470-123082492 GACCATGGGAAAATGTCTCCAGG - Intergenic
1015054435 6:128883036-128883058 TTCCATGGGCACGCGGCCCCAGG - Intergenic
1015236179 6:130973845-130973867 CACCATGGGCACATGTCGTCAGG + Intronic
1016681142 6:146830600-146830622 AACCTTGGGCACGTGTTCTCAGG + Intergenic
1016871088 6:148817428-148817450 CACCTTGGGCACGTGTTCTCAGG - Intronic
1018694592 6:166382237-166382259 GACCATGGGGACGCCTCTCCCGG - Intronic
1019068422 6:169321983-169322005 GACCGTGGGCATGTGTTCTCAGG - Intergenic
1019151472 6:170008852-170008874 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1019252549 7:25690-25712 GACCTTGGGCACATGTTCTCAGG + Intergenic
1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG + Intergenic
1022677712 7:32515150-32515172 CACCTTGGGCATGTGTCCTCAGG + Intronic
1022679233 7:32528311-32528333 CACCTTGGGCATGTGTCCTCAGG + Intronic
1024946903 7:54817489-54817511 CACCATGGGCACATGTCATCAGG + Intergenic
1026291600 7:69011355-69011377 CACCTTGGGCACATGTCACCAGG - Intergenic
1028281718 7:88937976-88937998 CACCTTGGGCACATGTTCCCAGG - Intronic
1029443291 7:100600009-100600031 GACCCTGGCCGTGTGTCCCCAGG + Exonic
1029728394 7:102423812-102423834 GACTATAGGCATGTGTCACCAGG + Intronic
1030236801 7:107272446-107272468 CACCTTGGGCACGTGTCATCAGG + Intronic
1030877363 7:114831662-114831684 CACCTTGGGCACATGTTCCCAGG + Intergenic
1032457916 7:132087586-132087608 GTCCATGTGCATGTGCCCCCGGG + Intergenic
1032547597 7:132756575-132756597 GATCAGGGACACTTGTCCCCAGG + Intergenic
1032612138 7:133426005-133426027 CACCTTGGGCACGTGTTCTCAGG + Intronic
1032801332 7:135319400-135319422 CACCTTGGGCACATGTCCTCAGG + Intergenic
1033120046 7:138659655-138659677 TACCTTGGGCACATGTCCTCAGG + Intronic
1033162402 7:139009281-139009303 CACCTTGGGCACATGTTCCCAGG + Intergenic
1035687043 8:1531914-1531936 CACCTTGGGCACATGTCCTCAGG - Intronic
1036212443 8:6853370-6853392 GACCTTGGGCACATGTCCTCAGG - Intergenic
1036289227 8:7472736-7472758 CACCTTGGGCACATGTCCTCAGG - Intronic
1036332254 8:7838791-7838813 CACCTTGGGCACATGTCCTCAGG + Intronic
1037554585 8:20009801-20009823 TACCTTGGGCACTTGTCCTCAGG - Intergenic
1039514436 8:38119985-38120007 GATTATAGGCACGTGCCCCCAGG - Intronic
1039799339 8:40940750-40940772 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1039953009 8:42186570-42186592 AACCTTGGGCACATGTCCTCAGG + Intronic
1041317692 8:56581642-56581664 GACCTTGGGCACATGTTCTCAGG + Intergenic
1042271904 8:66963082-66963104 GATCGTGGGCACTTCTCCCCGGG + Intergenic
1044593802 8:93939600-93939622 CACCATGGGCACATGTTCTCAGG - Intergenic
1046361071 8:113156791-113156813 GACTATGGGCATGTGCCACCAGG - Intronic
1047111013 8:121789588-121789610 CACCTTGGGCACATGTCACCAGG + Intergenic
1048352096 8:133624564-133624586 CACCTTGGGCACATGTCACCAGG + Intergenic
1048655989 8:136536389-136536411 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1048800635 8:138190991-138191013 CACCTTGGGCACGTGTTCTCAGG + Intronic
1049376864 8:142293518-142293540 GACCCTGGGCAGGTCTCTCCTGG - Intronic
1050330210 9:4538173-4538195 CACCTTGGGCACATGTCCTCAGG - Intronic
1051513537 9:17906079-17906101 GTCCGTGGGGACTTGTCCCCTGG - Intergenic
1052637319 9:31121770-31121792 GACCATGGGGAAATGTCTCCAGG - Intergenic
1054911286 9:70457659-70457681 CACCATGGGCACATGTCCTCAGG - Intergenic
1057079610 9:92163095-92163117 TACCATGGGCACATGTCATCAGG + Intergenic
1058531861 9:105913920-105913942 TACCTTGGGCACGTGTTCTCAGG + Intergenic
1059215289 9:112555935-112555957 GATTATAGGCACGTGTCACCAGG - Intronic
1059401015 9:114070803-114070825 GACCCTGGGGACATGGCCCCTGG - Intronic
1062492208 9:136811168-136811190 CACCTTGGGCACATGTCCTCAGG - Intronic
1062747819 9:138226682-138226704 GACCTTGGGCACATGTTCTCAGG - Intergenic
1185584059 X:1232021-1232043 AAGCATGGGCACGTGTCATCAGG + Intergenic
1185645896 X:1615427-1615449 CACCCTGGGCACATGTCCTCAGG - Intronic
1185785157 X:2884690-2884712 CACCTTGGGCACATGTCGCCAGG + Intergenic
1186329764 X:8519475-8519497 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1187239047 X:17496016-17496038 GACCATGGCCATGTATCCTCTGG - Intronic
1187806790 X:23129340-23129362 CACCTTGGGCACGTGTCCTCAGG + Intergenic
1192962613 X:76146055-76146077 CACCTTGGGCACGTGTCGTCAGG - Intergenic
1192962918 X:76149032-76149054 CACCTTGGGCACGTGTCGTCAGG + Intergenic
1193278934 X:79625258-79625280 GACCATGGCTATGTTTCCCCAGG + Intergenic
1193302656 X:79908958-79908980 CACCATGGGCACATGTTCTCAGG + Intergenic
1193882091 X:86936101-86936123 GTCCATGTGCACGTGTACACTGG + Intergenic
1194044400 X:88984032-88984054 CACCTTGGGCACGTGTCATCAGG - Intergenic
1194492490 X:94569045-94569067 CACCTTGGGCACATGTCACCAGG - Intergenic
1194534063 X:95084505-95084527 CACCTTGGGCACATGTCCTCAGG - Intergenic
1195487029 X:105421057-105421079 CACCATGGGCACATGTCATCAGG - Intronic
1199251256 X:145664871-145664893 CACCTTGGGCACATGTCACCAGG + Intergenic
1199398373 X:147367368-147367390 CACCTTGGGCACGTGTCATCAGG - Intergenic
1200232470 X:154450955-154450977 GACCGTGGGCACCTGTCCTTGGG + Intergenic
1200828414 Y:7666632-7666654 GACTATAGGCACGTGCCACCAGG - Intergenic
1201288707 Y:12401479-12401501 CACCTTGGGCACATGTCGCCAGG - Intergenic