ID: 948385207

View in Genome Browser
Species Human (GRCh38)
Location 2:237576555-237576577
Sequence AGCTGGGGCCTTTTCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948385201_948385207 -7 Left 948385201 2:237576539-237576561 CCACAGCCTCCATTGAAGCTGGG 0: 1
1: 8
2: 682
3: 26602
4: 343490
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218
948385196_948385207 11 Left 948385196 2:237576521-237576543 CCCCACTTCTCCATCTCTCCACA 0: 1
1: 0
2: 5
3: 61
4: 617
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218
948385199_948385207 1 Left 948385199 2:237576531-237576553 CCATCTCTCCACAGCCTCCATTG 0: 1
1: 0
2: 7
3: 51
4: 574
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218
948385197_948385207 10 Left 948385197 2:237576522-237576544 CCCACTTCTCCATCTCTCCACAG 0: 1
1: 0
2: 3
3: 52
4: 453
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218
948385195_948385207 23 Left 948385195 2:237576509-237576531 CCAAAATCTTCACCCCACTTCTC 0: 1
1: 1
2: 1
3: 35
4: 475
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218
948385198_948385207 9 Left 948385198 2:237576523-237576545 CCACTTCTCCATCTCTCCACAGC 0: 1
1: 0
2: 4
3: 72
4: 681
Right 948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948385207 Original CRISPR AGCTGGGGCCTTTTCTCTTT GGG Intronic
901686045 1:10944068-10944090 AGCTGGTCCAGTTTCTCTTTTGG - Intergenic
904651364 1:32008372-32008394 GGCTGGGGCCTTTTGTCTCCTGG + Intergenic
906129408 1:43447197-43447219 ACCTGTGGCCTGTTCTTTTTTGG - Intronic
906168713 1:43706715-43706737 GGCTGGGGCCAGTTCTCTTGAGG - Intronic
907900642 1:58738387-58738409 TACTGTGGCCTTTTCTCTTCTGG - Intergenic
913415820 1:118605882-118605904 AGCTGGGGCATCTTCTCATAGGG - Intergenic
916712944 1:167427966-167427988 AGCTGAAGCCTTCTCTCTGTGGG - Intergenic
917147259 1:171905560-171905582 AGCTGAGGATTTTTCTTTTTCGG + Intronic
918909299 1:190544932-190544954 AGCAGGAGCCTTGTCTGTTTTGG - Intergenic
919620096 1:199855133-199855155 CACAGAGGCCTTTTCTCTTTCGG - Intergenic
923211823 1:231810508-231810530 AGCTTGTGCTTATTCTCTTTGGG - Intronic
1063814512 10:9757327-9757349 AGATGGGGCCTTTCCCCGTTTGG - Intergenic
1065127217 10:22585080-22585102 ATGTGGAACCTTTTCTCTTTTGG + Intronic
1065655111 10:27940637-27940659 AGCTGGGGGCATTCCTCTGTTGG - Exonic
1066653413 10:37680015-37680037 GGCGGGGGCCTTTCTTCTTTAGG - Intergenic
1068854387 10:61782503-61782525 ACTTCGGGCATTTTCTCTTTTGG + Intergenic
1068960345 10:62861002-62861024 AGCTGCAGCTTTTTATCTTTTGG + Intronic
1071088884 10:81896369-81896391 ATCTCGTGCCATTTCTCTTTAGG + Intronic
1072417684 10:95262708-95262730 AGATGGGGCCAATTCTCTGTAGG - Intronic
1072490588 10:95902208-95902230 AGCTGGGCCTTGTTCTCTTTTGG + Intronic
1072776916 10:98206908-98206930 ATCTTGTTCCTTTTCTCTTTTGG - Intronic
1073064194 10:100748750-100748772 GGCTCGGGCTTTTGCTCTTTCGG - Intronic
1073934063 10:108609480-108609502 AGCTGGAGGCTGTTATCTTTAGG + Intergenic
1074347951 10:112706618-112706640 AGTTGGGAGCTTTTCTCTTACGG + Intronic
1074389836 10:113047861-113047883 AGCTGGGGCCTGTTGTGCTTGGG + Intronic
1075883249 10:125873043-125873065 AGCTGGGGCCTGGGGTCTTTAGG + Intronic
1077420066 11:2445876-2445898 ATCAGGGGCCTTCTCTCTTGGGG - Intronic
1077490597 11:2859215-2859237 GGCTGAGGCCTGGTCTCTTTAGG - Intergenic
1077811344 11:5640771-5640793 GGGTGAGGCCTTTTCTCTGTAGG + Intronic
1077994938 11:7444956-7444978 GGATGGGGTCTTTTCACTTTGGG + Intronic
1078845495 11:15115475-15115497 AGCTGGGGTGTCTTCTCTGTGGG + Intronic
1079807401 11:24950693-24950715 AACTGGTGCTTTTTTTCTTTGGG - Intronic
1080061614 11:27962352-27962374 AGATGGTGCCTTTCCTCTTAGGG - Intergenic
1081189799 11:40089463-40089485 ACCTGGGAGCGTTTCTCTTTTGG - Intergenic
1081667885 11:44927130-44927152 AGATCAGGCCTTTTCTCTGTGGG + Intronic
1082221284 11:49640728-49640750 AGCAGGGGCATCTACTCTTTTGG - Intergenic
1083415100 11:62520438-62520460 AACTTGGGCATTTTCACTTTGGG + Exonic
1083415328 11:62521830-62521852 AACTTGGGCATTTTCACTTTGGG + Exonic
1083415615 11:62523588-62523610 AACTTGGGCATTTTCACTTTGGG + Exonic
1084081097 11:66825494-66825516 CTCTGGGGCCTTTTTTTTTTTGG - Intronic
1084557070 11:69881636-69881658 ACCTGGGGCCTCTTCTCCTGGGG - Intergenic
1085345942 11:75768401-75768423 GGGTCGGGCCTTTACTCTTTAGG - Intronic
1085679812 11:78562642-78562664 AACTGAGGAATTTTCTCTTTAGG - Intronic
1086193646 11:84110655-84110677 AGGTGGGGCCTTTTCTCTGATGG - Intronic
1088087523 11:105999245-105999267 AGAGGAGGCCTTTTCTCTTACGG + Intronic
1088212567 11:107472972-107472994 AGCTGGGGCATTTTTCCTTAGGG - Intergenic
1089253325 11:117180373-117180395 AGCTGTGGTTTTTACTCTTTTGG + Intronic
1091015948 11:132050813-132050835 GGCTGGTGTCTCTTCTCTTTTGG + Intronic
1091621782 12:2094451-2094473 AGCAGGGGCCTCCTCTCTTTTGG + Intronic
1093496185 12:19760902-19760924 AGTTGGAGTCTTTCCTCTTTGGG + Intergenic
1095450467 12:42325887-42325909 AGCTGCGGCCTTCTCTCCTGCGG - Intronic
1096072258 12:48781978-48782000 AGCTGGGGTCAGTTCTCTCTGGG - Intronic
1096585904 12:52619475-52619497 GGCTGGGGCCTGTGCTTTTTGGG - Intergenic
1097396192 12:59077763-59077785 AGCTGGGAACTTTTGTTTTTAGG - Intergenic
1097472603 12:60013754-60013776 AGCTGTGGCCTTTTATTCTTTGG + Intergenic
1099734789 12:86553279-86553301 ACCTTGGGCCATTTCTTTTTAGG + Intronic
1101538824 12:105645750-105645772 ATCTTGGCCCTCTTCTCTTTAGG + Intergenic
1101737489 12:107474080-107474102 AGCCGAGGCCATTTCTCCTTTGG + Intronic
1101749253 12:107569973-107569995 AGGTTGGGCCTCTTCCCTTTGGG + Intronic
1102236667 12:111298237-111298259 AGCCGGGGGCTGTTCTCTTGAGG + Intronic
1104017424 12:124970421-124970443 GCCTGGTGCCTTTTTTCTTTTGG - Intronic
1105014421 12:132777448-132777470 TGCTGGGGCGCTTTCTCTCTTGG + Intronic
1105437278 13:20390114-20390136 AGCTGGCCCCTCTTATCTTTAGG - Intergenic
1106871783 13:34029614-34029636 AGCTGTGGCCTGTTCTAATTTGG + Intergenic
1109428832 13:62205218-62205240 AACTGGGGCCTTTTCTAGTGCGG + Intergenic
1112002142 13:95220794-95220816 AACAGGGTCATTTTCTCTTTTGG - Intronic
1112005273 13:95248154-95248176 AGCTGGGTCCTCTGTTCTTTGGG - Intronic
1112966483 13:105202740-105202762 AGCTGATGCCTCTTATCTTTTGG + Intergenic
1116757372 14:48964746-48964768 AGCTGAGGGCTTTTAGCTTTAGG + Intergenic
1118103759 14:62635015-62635037 AGCTCTGGGCTTTTCTTTTTGGG - Intergenic
1121944431 14:98105342-98105364 AGCTGAAGCCTTTTCTCCTAGGG + Intergenic
1122104038 14:99437593-99437615 ATCTAGTGCCTTTTCTTTTTTGG - Intronic
1122182769 14:99967904-99967926 AGCTGGAGCTTTTTTTTTTTTGG - Intergenic
1123008846 14:105337640-105337662 AGCTTGGGCCTCTCGTCTTTTGG + Intronic
1124967082 15:34441574-34441596 AGCTGAGGCCTTTTGTATCTTGG + Intergenic
1125346593 15:38724798-38724820 AGCTGGAGGCTGTTATCTTTAGG - Intergenic
1125904290 15:43376225-43376247 AGGTGGGTCCTGTTCTCTGTGGG + Exonic
1128807775 15:70545559-70545581 AGCTGGGGACTTTTCCCTTTGGG + Intergenic
1130124582 15:81082423-81082445 AGCTGGGTTCTATTCTCCTTGGG + Intronic
1130785125 15:87087484-87087506 AGCTGAGGCCTTTTATCTGCAGG - Intergenic
1131425817 15:92344647-92344669 AAATGGGATCTTTTCTCTTTGGG + Intergenic
1131685306 15:94760941-94760963 AGCTGGGGCCTGTACTACTTTGG - Intergenic
1133375220 16:5280557-5280579 AGTTTAGGGCTTTTCTCTTTTGG + Intergenic
1133639860 16:7706312-7706334 AGCTGCCTCCTTTTCTCTTCAGG - Intronic
1134335490 16:13295606-13295628 AGCTGGGGTCTTTTCACCTCGGG + Intergenic
1135223246 16:20632553-20632575 GGCCTAGGCCTTTTCTCTTTTGG - Intronic
1136402213 16:30025036-30025058 AGATGGGGCCTCTTCCCTTTCGG + Exonic
1137621173 16:49877384-49877406 AGCTGGAGCCTGGGCTCTTTAGG + Intergenic
1138598845 16:58043380-58043402 AGATGGGGCCTTCTCCCCTTAGG - Intronic
1138792365 16:59920909-59920931 AGCTGTTGCCTTACCTCTTTGGG + Intergenic
1139043433 16:63028676-63028698 AAGTGGGGCCTTTTCTGCTTAGG - Intergenic
1139573362 16:67826848-67826870 AGCTGGGGCCTATTCCCCTTGGG + Intronic
1141098169 16:81177730-81177752 AACAGGGGCCTGTTCTCTCTGGG - Intergenic
1143597063 17:7921502-7921524 TGCTGCTGACTTTTCTCTTTTGG + Intergenic
1143896611 17:10141442-10141464 AGCAGTGGCCTTTTTTTTTTTGG - Intronic
1147363105 17:39943810-39943832 GGCTGGGGCCTCTTCTCTGGGGG - Intronic
1147945090 17:44076251-44076273 TGCTGTTGCCTTTGCTCTTTGGG - Exonic
1147954006 17:44122533-44122555 AGCTGTTACCTTTCCTCTTTAGG + Intronic
1148222065 17:45870021-45870043 ACCCAGGGCCTTTCCTCTTTGGG + Intergenic
1148935327 17:51160525-51160547 GGCAGGGGCCTTCTCTCTTAGGG + Intronic
1151249423 17:72822048-72822070 GGCTGGGGCCATTTCTCCCTGGG + Intronic
1152726332 17:81948562-81948584 AGCTGCGCCTCTTTCTCTTTCGG + Intergenic
1156448156 18:37252020-37252042 AGCAGGGGCCTTCTCTCTGGGGG - Intronic
1159509539 18:69378562-69378584 AGGTGGGGCATTTTCTCTGGTGG + Intergenic
1162435673 19:10656524-10656546 GGCTGGGGCCTCTTCTCTTAGGG + Intronic
1163651640 19:18521504-18521526 AGCTGGGGGCTTTTCCATCTGGG - Intronic
1168692899 19:58387405-58387427 GGCCTGGGCCTTTTCTCATTAGG + Exonic
925150351 2:1611159-1611181 AGCTGGGGACCCTTCTCATTCGG - Intergenic
925150519 2:1611832-1611854 AGCTGGGGACCCTTCTCGTTCGG - Intergenic
925319768 2:2953646-2953668 TTCTGGGGTCTTTTTTCTTTTGG - Intergenic
925754318 2:7119278-7119300 ATGTTGGGCCTTTTCTCTTTTGG - Intergenic
928716770 2:34070582-34070604 AGCTTTGGCATTTTCCCTTTTGG - Intergenic
928950029 2:36806232-36806254 AGCTGGAGCCTTTTCTTTGGAGG - Intronic
930905294 2:56559022-56559044 AGCTGGAGGATGTTCTCTTTGGG + Intergenic
930980390 2:57518782-57518804 AAATGTGGTCTTTTCTCTTTAGG - Intergenic
931518434 2:63069421-63069443 AGCTGTGAGTTTTTCTCTTTTGG - Intergenic
931683050 2:64768551-64768573 ATTTGGGTCCTTTTCTATTTTGG + Intergenic
932769292 2:74491634-74491656 TGCTGGGGCCTCTCCTCTCTTGG - Exonic
933858521 2:86441685-86441707 ACCAGGGGCCTTTTCTTTTCGGG + Intronic
935133913 2:100281878-100281900 AGCTGGGGTTTTTTTTTTTTAGG + Exonic
936743971 2:115551099-115551121 AGATGGGGCATTCTCTCTTCAGG + Intronic
938936241 2:136129995-136130017 TGCTGGGGACTTTTTTCTATGGG + Intergenic
940128738 2:150357440-150357462 AAATGGGGCCTTTTCTCAATAGG + Intergenic
941575861 2:167229055-167229077 TGCTGTGACCTTTTGTCTTTGGG - Intronic
942313023 2:174673113-174673135 AGTTGGCACCTTTTCTCTTGCGG - Intronic
945984244 2:216341306-216341328 AGCTGGTGCCTTTTGCCTTGTGG - Intronic
946450769 2:219777157-219777179 GGCTGTGGCCTTTTTGCTTTTGG + Intergenic
946590121 2:221237212-221237234 AGCTGGGGGCATATCTATTTTGG - Intergenic
948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG + Intronic
1169150275 20:3284013-3284035 GCCTGGGGCCTTCTCTCTTGAGG - Intronic
1171093729 20:22311421-22311443 ATCTGGGGCTGTGTCTCTTTTGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172955761 20:38757247-38757269 TGCTGGGGCCTAAGCTCTTTTGG - Intronic
1173993026 20:47317497-47317519 AGCTGCGGCCCTTTCCCTTGAGG - Intronic
1174702217 20:52620506-52620528 GGCTGGCTCCTTTTATCTTTTGG + Intergenic
1175334185 20:58184442-58184464 AGCTTCTGCCTTTACTCTTTTGG - Intergenic
1175419228 20:58820947-58820969 AGCTGGGGTCTTTTCACTGAAGG - Intergenic
1177857178 21:26412653-26412675 AGCAGGAACTTTTTCTCTTTTGG + Intergenic
1180017837 21:45098727-45098749 AGCTGGAGGCTGTTCTCTTTGGG + Intronic
1182749310 22:32628881-32628903 AGTGGGGGCCTTTTCTCTGAAGG + Intronic
1183062542 22:35345112-35345134 AGATGGGGACATTTCACTTTCGG - Intronic
950489873 3:13297674-13297696 AGCTGGGTCCCTTGCTCTCTGGG + Intergenic
951557884 3:23938931-23938953 AGCTGGGCACTTCCCTCTTTAGG - Intronic
951669755 3:25167525-25167547 AGCTGGTGCCTCTGCTCTCTGGG - Intergenic
952012625 3:28917950-28917972 AGCTGATGCATTTTCACTTTAGG + Intergenic
953059860 3:39418323-39418345 ACCTGTGGGCTTTTCTCGTTAGG + Intergenic
955776994 3:62444162-62444184 AGCTGTGGTCTATTCTCTGTAGG - Intronic
957456800 3:80461731-80461753 AGCTGGTGCCTTATATATTTTGG + Intergenic
961030663 3:123600742-123600764 AGCTGGGGCCTGTTTACTGTGGG + Intergenic
962368891 3:134804633-134804655 AGCTGCTGCTTTTTGTCTTTGGG + Intronic
963835676 3:150055882-150055904 AGCTGTTCGCTTTTCTCTTTAGG - Intergenic
964673043 3:159247880-159247902 TTCTGAGGCCTTTTCTCCTTCGG + Intronic
966377974 3:179316600-179316622 ACCTGTGGGCATTTCTCTTTAGG + Intergenic
966629404 3:182055889-182055911 AGCTGGTGACTTTTCTCATGGGG - Intergenic
966701661 3:182860135-182860157 ACCTGTGGCTTATTCTCTTTTGG + Intronic
967340342 3:188390229-188390251 AGCTGGTTTCTCTTCTCTTTTGG + Intronic
967597110 3:191339203-191339225 AGCTGAAGCCTTTTTGCTTTGGG + Intronic
969802010 4:9575279-9575301 AGCCTAGGGCTTTTCTCTTTTGG + Intergenic
971049970 4:22850501-22850523 AGCTTGGGCATTACCTCTTTTGG + Intergenic
971887535 4:32472979-32473001 AGCTGGGCTCTTTTCACTTGGGG + Intergenic
972215721 4:36895154-36895176 AGCTGGGACCATTTTTCTATGGG + Intergenic
973117845 4:46483556-46483578 AACTTGGGCATTTTCTCTCTTGG - Intergenic
975266141 4:72370173-72370195 GGCTGGGACCTTAGCTCTTTTGG - Intronic
978000090 4:103547039-103547061 AGGTGGCACCTTTGCTCTTTTGG - Intergenic
978591405 4:110328621-110328643 AGCTGGGTCCTTTTCTGATATGG + Intergenic
980641395 4:135585253-135585275 AGCTGGGGCCTTGGAGCTTTGGG + Intergenic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
983005872 4:162484197-162484219 AGCTCGTAGCTTTTCTCTTTCGG - Intergenic
983406219 4:167334717-167334739 AGCTTGGGCCCTTTAACTTTGGG + Intergenic
987379959 5:17275701-17275723 AGCTGGGGCCCCGTCACTTTTGG - Exonic
989515839 5:42341365-42341387 AGTTGGGGTCTTTTCTGTATTGG - Intergenic
989554594 5:42778579-42778601 AGGGGGAGCCTTTTCTTTTTAGG - Intronic
991431740 5:66555103-66555125 ATCTGGGTTCTTTTCACTTTTGG + Intergenic
995246092 5:109937237-109937259 AGCTGAGGCATTTACACTTTGGG + Intergenic
996165634 5:120219248-120219270 AGCAGGGTCCTTATCTCTCTAGG - Intergenic
997422954 5:133783671-133783693 AGCTGGGCCCTTTTCTTTGTGGG + Intergenic
1001208893 5:169791682-169791704 TGCTGGGGCCTTGCCTCTGTTGG + Intronic
1003420396 6:5952607-5952629 AGCTGCAGCCCTGTCTCTTTGGG + Intergenic
1004054704 6:12123630-12123652 AGACGGAGCCTTTTCTTTTTGGG - Exonic
1005797034 6:29375207-29375229 AGCTGCAGCCTTTCTTCTTTGGG - Exonic
1006104176 6:31706701-31706723 GGCTGGGTCCTTTTCTCTCCAGG + Intronic
1006387461 6:33739303-33739325 AACTGAGGCCCTTTCTCTTGGGG + Intronic
1011535757 6:88374371-88374393 AGTTGGGGCCTTTGCCCTTAGGG - Intergenic
1011921615 6:92584051-92584073 AGCTGTGCTTTTTTCTCTTTAGG + Intergenic
1013036499 6:106389690-106389712 AGCTGGGTACTTTTGTCTGTGGG + Intergenic
1013349883 6:109295962-109295984 AGCTGGGTACTTTACTCTCTGGG + Intergenic
1014075468 6:117229994-117230016 AGCTGGAGGCTATTATCTTTAGG - Intergenic
1019089341 6:169513842-169513864 AGCAGAGACATTTTCTCTTTAGG - Intronic
1019847311 7:3518247-3518269 AGCATGAGCCTTTTCTCTTCAGG + Intronic
1029345380 7:99974881-99974903 ATCTGAGGCTTTTTCTCTTAAGG - Intronic
1029405700 7:100373105-100373127 AGCTGGGGGCTCTTCTGCTTGGG + Intronic
1031152571 7:118071404-118071426 AGCAGGAGCATTTTCTCCTTTGG - Intergenic
1031959375 7:127975024-127975046 AAATAGGGCTTTTTCTCTTTGGG - Intronic
1033423311 7:141221518-141221540 AGCTGGGGCTTTTCTTCCTTTGG - Intronic
1035933529 8:3810833-3810855 AGATGGGGCCATTGATCTTTAGG + Intronic
1036101466 8:5791042-5791064 TGCTGGGGTCTTTTATCTGTGGG - Intergenic
1036511850 8:9407645-9407667 TGCTAGGGCTTTGTCTCTTTAGG - Intergenic
1036538207 8:9673419-9673441 ATTTGGGGCCTTTTACCTTTTGG + Intronic
1037319007 8:17626735-17626757 TGCTGGTGGCTTTTCTTTTTTGG - Intronic
1038555755 8:28513576-28513598 AGTTTGGACCTTTTCTCATTAGG + Intronic
1039862632 8:41471909-41471931 ACCTGGAGCCTTCTCTCTTGAGG + Intergenic
1041200105 8:55445531-55445553 TTCTAGGGCCTTTTCTCTTAGGG - Intronic
1042855581 8:73263700-73263722 AGCAGGGACCTTATCTCCTTGGG - Intergenic
1048792100 8:138113563-138113585 AGCAGGGATCTTTTCTGTTTGGG + Intergenic
1051817972 9:21132102-21132124 CCTTGGGGCCTGTTCTCTTTGGG - Intergenic
1053131016 9:35615771-35615793 AGCTTGGTCCTTCTCTCTGTTGG + Intronic
1054812952 9:69449253-69449275 AGCTGAGGCCATTTCTGTTGAGG + Intronic
1056972340 9:91216768-91216790 GCCTGGGGCCTTCACTCTTTTGG + Intronic
1057459283 9:95244980-95245002 AGCTGGGCACTGTTCTCTGTGGG - Intronic
1058001767 9:99873055-99873077 TGCTGGGGCCTCTTTTCCTTAGG + Intergenic
1059600624 9:115773967-115773989 GGATGGTGCCTTTTCACTTTCGG - Intergenic
1061002856 9:127912209-127912231 AGCTGGGGCCTTCCTTCTCTGGG - Intronic
1062253056 9:135607992-135608014 AGCCTGGGCCTATTCTCTTTGGG + Intergenic
1185920700 X:4088786-4088808 AGCTTAGACCTTTTCCCTTTAGG + Intergenic
1187203813 X:17161849-17161871 AGAAAGGGCCTTTTATCTTTTGG - Intergenic
1187484833 X:19693613-19693635 AGAAGGGGCATTTTCTCTTCTGG - Intronic
1188019168 X:25138181-25138203 ACCTGTAGCCTTTTCTCTTTTGG + Intergenic
1188791229 X:34410162-34410184 AGCTGTGGGCTTTTCACATTTGG - Intergenic
1189906898 X:45770446-45770468 AGCCTGGGCGTTTTCTGTTTCGG - Intergenic
1190172708 X:48124243-48124265 AGCTGTGGTCTTGTCTCCTTGGG + Intergenic
1190178301 X:48169452-48169474 AGCTGTGGTCTTGTCTCCTTGGG + Intergenic
1190179886 X:48183295-48183317 AGCTGTGGTCTTGTCTCCTTGGG - Intergenic
1190184283 X:48221295-48221317 AGCTGTGGTCTTGTCTCCTTGGG + Intronic
1190192900 X:48292531-48292553 AGCTGTGGTCTTGTCTCCTTGGG - Intergenic
1190198816 X:48343061-48343083 AGCTGTGGTCTTGTCTCCTTGGG - Intergenic
1190205090 X:48396167-48396189 AGCTGTGGTCTTGTCTCCTTGGG + Intergenic
1190205446 X:48399236-48399258 AGCTGTGGTCTTGTCTCCTTGGG - Intergenic
1190458113 X:50644681-50644703 TGCTAGGGCCTTTCCTCTCTGGG + Intronic
1190669719 X:52729292-52729314 AGCTGTGGTCTTGTCTCCTTGGG - Intergenic
1190760082 X:53431690-53431712 AGCAGCAGCCTTTTATCTTTGGG - Intronic
1197800946 X:130347961-130347983 ATCTGGGGCTATTTCTTTTTGGG + Intronic