ID: 948385325

View in Genome Browser
Species Human (GRCh38)
Location 2:237577289-237577311
Sequence GATGCTGGTGGGCAACAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948385325_948385331 -5 Left 948385325 2:237577289-237577311 CCGTCTTGTTGCCCACCAGCATC 0: 1
1: 1
2: 3
3: 19
4: 221
Right 948385331 2:237577307-237577329 GCATCACCAGGACTTCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 153
948385325_948385330 -6 Left 948385325 2:237577289-237577311 CCGTCTTGTTGCCCACCAGCATC 0: 1
1: 1
2: 3
3: 19
4: 221
Right 948385330 2:237577306-237577328 AGCATCACCAGGACTTCTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 181
948385325_948385334 13 Left 948385325 2:237577289-237577311 CCGTCTTGTTGCCCACCAGCATC 0: 1
1: 1
2: 3
3: 19
4: 221
Right 948385334 2:237577325-237577347 CTGGGTGCAGCTCCTCCTCCAGG 0: 1
1: 0
2: 6
3: 55
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948385325 Original CRISPR GATGCTGGTGGGCAACAAGA CGG (reversed) Exonic
900246251 1:1637489-1637511 GATTGTGGTGGGCAGCAACATGG - Exonic
900257478 1:1704631-1704653 GATTGTGGTGGGCAGCAACATGG - Exonic
900644158 1:3701462-3701484 GATGGTTGTGGGGATCAAGAGGG - Intronic
901196766 1:7444612-7444634 GATGATGTTGGGCAAGCAGAGGG + Intronic
901458624 1:9378139-9378161 GAAGCTGCTGGGCCACAAGGAGG - Intergenic
901944144 1:12687262-12687284 GATGCTGCTCAGCAAAAAGAAGG + Intergenic
902924264 1:19685466-19685488 TATGTTGGTGAGCAACAAGTAGG + Intronic
904034825 1:27552925-27552947 GATCTCTGTGGGCAACAAGACGG + Exonic
904484310 1:30814750-30814772 GTAGCGGGTGGGAAACAAGAAGG - Intergenic
911476321 1:98377912-98377934 GATGCTGGTGGGCAAGAGTTTGG - Intergenic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912450537 1:109765140-109765162 GAAGCTGAAGGGCCACAAGATGG - Intronic
912484171 1:110011394-110011416 GATTCTGATGGCCAACAAGAGGG - Intronic
912592327 1:110836000-110836022 GATGCTAGTGGGGGCCAAGATGG + Intergenic
912797649 1:112702613-112702635 CATCCTGGTGGGGAATAAGAAGG - Exonic
913214304 1:116607766-116607788 TATGCAGGTGGGCTACAACAGGG + Intronic
914850228 1:151308680-151308702 GGTGCAGGTGGGGAAAAAGAGGG + Intronic
915684237 1:157615582-157615604 CTTGCTGGTGGGCAAGAAGCAGG - Intergenic
916056725 1:161073361-161073383 GAGGCTGGTGGAGGACAAGAGGG - Intronic
916405489 1:164494170-164494192 GGAGCTGTTGGCCAACAAGATGG + Intergenic
916515463 1:165512572-165512594 GATTCTGGGGGCCAAAAAGAGGG - Intergenic
917064958 1:171082439-171082461 TATGCTTGTGGGTAACACGATGG - Intergenic
919436644 1:197571102-197571124 GATGGTGGTAGTAAACAAGATGG - Intronic
920353863 1:205356126-205356148 GATGCAGATGGACATCAAGATGG - Intronic
921086594 1:211799657-211799679 GATGGTGGATGGCAACAATAAGG + Intronic
922719333 1:227892345-227892367 GATGCAGGTGGGCAGGGAGATGG + Intergenic
1062801810 10:386555-386577 GATGCTGTTGGGGGATAAGATGG - Intronic
1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG + Intronic
1068847781 10:61699441-61699463 GATGCTCGTGGGCCAACAGATGG - Intronic
1069166758 10:65169645-65169667 GATGGTGGTGGCCAAAAACAAGG - Intergenic
1070219888 10:74430341-74430363 GAAGTGGGTGGGCAACATGAAGG - Intronic
1070542578 10:77427135-77427157 GATGCTGATGTGCACCAGGAAGG - Intronic
1070828584 10:79405260-79405282 GAGGCTTGTGGGAAACAAGATGG - Intronic
1072718714 10:97767911-97767933 GATGCTGGTGGGCACAGAGTTGG + Intronic
1072787358 10:98293345-98293367 GATGCTGGGGGGCAGCTAGATGG + Intergenic
1075421663 10:122305730-122305752 GATGGTGGTGGGTAGGAAGAGGG - Intronic
1075999863 10:126905769-126905791 GATGCGGGTCGGGAACACGAGGG + Intronic
1077633740 11:3827787-3827809 CCTGCTGGTGGGCACCAAGAAGG - Exonic
1077907310 11:6544532-6544554 AATGCTGGTGGGAAACACTAGGG - Intronic
1078385518 11:10888629-10888651 GATGTTAGTGGGCAATTAGATGG - Intergenic
1078533026 11:12151628-12151650 GAAGTTGGTGAGCCACAAGAAGG - Intronic
1078730503 11:13969831-13969853 AATGCTGGAGGGAAACTAGAAGG - Intronic
1080741288 11:35066680-35066702 GAAGCTGGTGGAGAACAATAAGG - Intergenic
1088428941 11:109736010-109736032 GGGGCTGGGGGGCAACAGGAGGG + Intergenic
1089148983 11:116350304-116350326 GATGCTCCTGGGGATCAAGAGGG + Intergenic
1089422781 11:118344178-118344200 GAAGGTGGTGGGGAAGAAGAGGG - Intergenic
1089661166 11:119986462-119986484 TAGGCTGGTGGGCAAGAGGAGGG + Intergenic
1089793449 11:120961082-120961104 GATGCTGGTGAGCAACCAAATGG - Intronic
1091792714 12:3280914-3280936 GGTGCTGGTGGGCAAGCACAGGG + Intronic
1092280351 12:7093163-7093185 GATGCGGGTGTGGAGCAAGAGGG + Intronic
1093396051 12:18683805-18683827 GATGATGGGTGGCAACCAGAAGG - Intronic
1095670091 12:44848532-44848554 GATGGGGGTGGGGAAGAAGAGGG - Intronic
1095993448 12:48055497-48055519 GAAGCTGGTGGGCAGGAAAAAGG - Intronic
1096747224 12:53736985-53737007 TGTGCTGGTGGACTACAAGAAGG - Intergenic
1096795020 12:54071356-54071378 GATGCTGGGGGGCAGGGAGAAGG + Intergenic
1096805149 12:54136046-54136068 GAGGCAGGTGGGGGACAAGAGGG + Intergenic
1097053691 12:56238091-56238113 AACGCTGGTGGGCAGCAATAAGG - Exonic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1097559790 12:61188943-61188965 CCAGCTGGCGGGCAACAAGATGG + Intergenic
1099688001 12:85913823-85913845 GATGCTGGGCAGCAACAAGATGG - Intergenic
1099838665 12:87938688-87938710 GATTCTGAAGGGGAACAAGAGGG - Intergenic
1100511287 12:95276914-95276936 GATGTGAGTGGGCAAAAAGAGGG - Intronic
1105395152 13:20025225-20025247 GATGCTCGTGGGTATGAAGACGG + Intronic
1105944263 13:25176256-25176278 AATGCTGGTAGGCACCAAGGGGG + Intergenic
1106796706 13:33213900-33213922 GATGCTAATGGGCATCAACAAGG + Intronic
1108483915 13:50905840-50905862 GATGCTTGTGGAGAACAGGATGG + Intergenic
1108504234 13:51096288-51096310 GATGGTGGTGAGAGACAAGAGGG + Intergenic
1109571899 13:64203788-64203810 TATGCTGGTGGGGAAGAATAAGG + Intergenic
1109647959 13:65285265-65285287 CATGCTGGTGGGAAACACTATGG - Intergenic
1110998037 13:82138710-82138732 CATGGTGGAGGGCAAAAAGAGGG - Intergenic
1113612188 13:111654956-111654978 GATGCTGGTGGGAATAATGAGGG + Intronic
1113727815 13:112618188-112618210 GACTCTGCTGGGCTACAAGATGG + Intergenic
1114445306 14:22783741-22783763 GATACTGGTGGACAAAGAGAGGG - Intronic
1121388781 14:93556237-93556259 CATGCTCTTGGGCAACTAGAAGG - Intronic
1122986376 14:105213551-105213573 GATGCTGGCGGGCAGGAATACGG + Intronic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1124609473 15:31198434-31198456 GATGCTGGCTGACAGCAAGATGG - Intergenic
1125373016 15:38998853-38998875 GATGCTGGATGGCCACAACAAGG + Intergenic
1126330595 15:47526700-47526722 GATGGTGGTTGGCACCAATATGG + Intronic
1127006516 15:54576717-54576739 TGTGCTGGTGGGGGACAAGAGGG - Intronic
1127819917 15:62645677-62645699 GGTGCTAGGAGGCAACAAGATGG - Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128133269 15:65244954-65244976 GATGCTGGGGGGATACAAGAAGG + Intronic
1128325594 15:66722065-66722087 GATGTTGGTGGGAGAAAAGATGG + Intronic
1130396713 15:83508776-83508798 CATGATGGTGGCCAACCAGATGG - Intronic
1132809733 16:1791799-1791821 GGTGCTGGCGGGCAACAGGCTGG - Exonic
1132878954 16:2152867-2152889 CATGCTGCTGGGGAACAAGGTGG + Exonic
1133483684 16:6197206-6197228 GATGCTTGGGGGCCACCAGAGGG - Intronic
1134518659 16:14907437-14907459 GAGGCTGTTGGGCAAGAAAATGG + Intronic
1134706330 16:16306090-16306112 GAGGCTGTTGGGCAAGAAAATGG + Intergenic
1134961210 16:18406020-18406042 GAGGCTGTTGGGCAAGAAAATGG - Intergenic
1134965512 16:18488623-18488645 GAGGCTGTTGGGCAAGAAAATGG - Intronic
1137440922 16:48497996-48498018 GCTGCTGCTGGGCTAGAAGAGGG - Intergenic
1137549361 16:49426633-49426655 AATGCTCATGGGCAACAACAGGG - Intergenic
1137596065 16:49724738-49724760 AATGCTGCTGTGCAACAAGCCGG - Intronic
1139446844 16:67003339-67003361 GATGCGTGTGTCCAACAAGATGG + Exonic
1139489270 16:67278061-67278083 GGTGCTGGTGGGCAGCAGAAGGG + Exonic
1141383016 16:83592736-83592758 GGGGCTGGTGGGCAAGGAGAAGG - Intronic
1141413266 16:83850873-83850895 GATGCGTGTGGGGAACAATAGGG - Intergenic
1143020735 17:3916141-3916163 GGTGCTGGTGCGTAATAAGAAGG - Exonic
1143057621 17:4173981-4174003 GGTCCTGCTGGGCAGCAAGATGG + Exonic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1144181040 17:12752845-12752867 GATGCTGGTGGAGAAGCAGAAGG + Exonic
1144391228 17:14795337-14795359 TATGCTAGTGGGCAAAGAGAGGG + Intergenic
1146884140 17:36459689-36459711 GATGCTGGTGAGCGGCAAGCAGG - Intergenic
1147398451 17:40163683-40163705 GAAGCTGGTGGGCAGCATGGTGG + Exonic
1149181963 17:53950563-53950585 GAGGCTGTTGGGACACAAGACGG - Intergenic
1149536466 17:57437456-57437478 GATGATGGTTGGCAATAGGATGG + Intronic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1154430528 18:14304799-14304821 GATGCTGGTGGGCAGTAGAAAGG + Intergenic
1156685231 18:39637121-39637143 GAAGTGGGTGGGCAACCAGAGGG - Intergenic
1158990724 18:62865881-62865903 GAGGCTGGAGGGCAGGAAGAAGG + Intronic
1162729043 19:12706589-12706611 CATCCTGGATGGCAACAAGAGGG - Exonic
1164400787 19:27900770-27900792 GAGGCTGGAGAGCAAAAAGAAGG - Intergenic
1165296904 19:34934763-34934785 GGGGCTGGGGGACAACAAGAGGG + Intronic
1165374857 19:35434529-35434551 GACGCTGGTGGGGAAGCAGAGGG - Intergenic
1166048479 19:40243543-40243565 GAAGCTGGTGGACAAGAAGTAGG + Intronic
925216938 2:2104731-2104753 GATGCTGGTGGGAATAAAGCAGG - Intronic
925408882 2:3627353-3627375 GATGATGCTGGGCAAGATGATGG + Intronic
926092763 2:10061326-10061348 GAGGATGGTGGGAAACAGGAAGG - Intronic
929114067 2:38429735-38429757 GAGGCTGGGGGGCAACTATATGG - Intergenic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
931882686 2:66583065-66583087 GATTCTGGTGGACAAAGAGAAGG + Intergenic
932096434 2:68853688-68853710 TGTACTGGTGGACAACAAGATGG + Intergenic
933570227 2:84002246-84002268 GATGATGGGGGGCAAGAGGAGGG - Intergenic
934091608 2:88555433-88555455 GATGTTGCTGGACTACAAGAAGG + Intergenic
937740751 2:125350233-125350255 GAGGGTGGTGGGCAAGGAGAGGG - Intergenic
939656750 2:144835721-144835743 GATGCTGAGGTGCAGCAAGATGG - Intergenic
941009539 2:160284001-160284023 GATCCTGATGGTCAACAAAAGGG + Intronic
942313642 2:174679554-174679576 GATGCTGATGTGCTACCAGAGGG - Intronic
942792527 2:179776674-179776696 GATGCTCGTGACCAACAACAAGG + Intronic
945499776 2:210557528-210557550 AATGCTGGGGGGCAGGAAGAAGG - Intronic
946362116 2:219225209-219225231 AATCCTGGTGGGGAAAAAGAAGG + Exonic
946860991 2:224000269-224000291 GGTGCTGGTGGCCAGGAAGAGGG + Intronic
947135508 2:226973347-226973369 GATGCTGGTGACCAAGAAGTGGG + Intronic
947312707 2:228821567-228821589 CCAGCTGGTTGGCAACAAGATGG + Intergenic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
1170565418 20:17599452-17599474 TATGCTGGTAGGCACCAAAAGGG - Intronic
1171221226 20:23399660-23399682 GAGGCTGGTGGGTATCCAGAAGG + Intronic
1173090299 20:39964413-39964435 GATACAGGTGAGCAACCAGATGG + Intergenic
1174607171 20:51769045-51769067 GATGATGGTGACCAACAGGAGGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179396384 21:41043978-41044000 GATGCTGATGGGCACCAAAGAGG + Intergenic
1179798646 21:43799992-43800014 GGTGCTGGTGGGGAATGAGATGG + Intronic
1181603045 22:23963683-23963705 GATGATGGTGGGAACCAGGATGG + Intergenic
1181605469 22:23977624-23977646 GATGATGGTGGGAACCAGGATGG - Intronic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1182511839 22:30825512-30825534 GAGACTGGTGGGCAACAATGGGG + Intronic
1182667062 22:31967684-31967706 AATGGTGGTGAGCAACAAGGAGG - Intergenic
1183332983 22:37231327-37231349 CATCCTGGTGGGCACCAAGCTGG - Exonic
1183986811 22:41574714-41574736 GATGCTGGCGGGCAGGAAGAGGG - Exonic
950101566 3:10360075-10360097 TCGGCAGGTGGGCAACAAGACGG - Exonic
950679197 3:14573419-14573441 GATCCTGGTGTGCAGGAAGAGGG + Intergenic
952188480 3:30996783-30996805 GATACTGGTGAGCAAACAGATGG - Intergenic
952231182 3:31432468-31432490 GATGCTGGGTGGCTACAAGCAGG + Intergenic
954472431 3:50708955-50708977 GATGATGGTGGGCTTCAAGATGG - Intronic
961241017 3:125411638-125411660 AAGGGTGGTGGGCAAGAAGAGGG + Intergenic
961559360 3:127718068-127718090 GATGCTGGTTTTCAACAAGCTGG - Intronic
962251631 3:133839522-133839544 CATGCTGGTGGGCAACAAGACGG - Exonic
964119035 3:153163026-153163048 GATCCTGGTGGGCAACAAGGTGG + Exonic
964220383 3:154337855-154337877 ATTACTGGTGGGCAAAAAGAGGG + Exonic
964743580 3:159990726-159990748 GAAGCTGGTGGGCAGCAGGAGGG - Intronic
965873737 3:173291583-173291605 GATTCTGGAGTGCAACAGGAAGG + Intergenic
965893126 3:173539259-173539281 GGTGCTGGTGGGGAGAAAGAAGG + Intronic
967926447 3:194652592-194652614 GATGCCAGTGGGCAACAAGAGGG + Intronic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969868304 4:10089611-10089633 CCTGCAGGTGGGCAGCAAGAGGG - Intronic
969944055 4:10764624-10764646 GAAGTTGATGGGCAACAATATGG + Intergenic
970449805 4:16155703-16155725 GATGCCCGGGGGAAACAAGAGGG - Intergenic
970895033 4:21092570-21092592 GATGCAGGTGGGAAGGAAGAAGG - Intronic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
972726908 4:41752417-41752439 GAGGCGGGTGGGTAACAGGATGG + Intergenic
973191036 4:47386200-47386222 GATTCTGGTGAGCATCTAGATGG - Intronic
973913877 4:55613104-55613126 GATGCACGTGGGCAAAGAGAAGG + Intronic
976000569 4:80369617-80369639 GATGCTGATCAGCAAAAAGAAGG - Intronic
976147385 4:82055383-82055405 GATGCTGGTGAGCAAGAGAAAGG + Intergenic
977037555 4:91974649-91974671 AATGCTGGAGGCCTACAAGAAGG - Intergenic
978729391 4:112007308-112007330 GATGCTGGTGGATCACAAAATGG + Intergenic
979360745 4:119761971-119761993 GATGCTACAGAGCAACAAGAGGG + Intergenic
980191270 4:129528268-129528290 GATGCTAGGGGGTAAAAAGAGGG - Intergenic
981360111 4:143836414-143836436 GATGTTGGTGTGGAACAAAATGG + Intergenic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
986077038 5:4348463-4348485 GATACTGGTGGGCAGCAGAAAGG - Intergenic
987900688 5:24007612-24007634 GAGGCTGGAGGGCGAGAAGAGGG - Intronic
992073175 5:73167338-73167360 GATGCAGGTTGCCACCAAGAAGG - Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
994085067 5:95749687-95749709 GAAGCTGGAGAGCAAAAAGATGG + Intronic
995213222 5:109564676-109564698 GAAGGTGGGGGGCAAGAAGAGGG - Intergenic
996798463 5:127376523-127376545 GGTGCTGGTGGGCAATGGGATGG + Intronic
997579641 5:135009171-135009193 GCTGATGGTGGTCAACAGGACGG + Intronic
997926100 5:138032696-138032718 GGCGCTGGGGGGCAACAGGAGGG + Intronic
998606398 5:143639686-143639708 GAGGGTGGGGGGCAAGAAGATGG - Intergenic
1002912925 6:1504969-1504991 GAAGCTGGTGGGGAGCAAGGAGG + Intergenic
1003475892 6:6482366-6482388 GATGCTGGTGGGGACCCAGTGGG + Intergenic
1004160341 6:13207297-13207319 GGTGTTGGAGGGAAACAAGAGGG + Intronic
1005582624 6:27248978-27249000 GATGCTGGTGGGGACCAGGAAGG + Intronic
1007112218 6:39319464-39319486 GCTGCTGGTGGCCAAAAGGATGG + Intronic
1008318810 6:50081106-50081128 GATGCTGGTGGAGAAAAAGAAGG - Intergenic
1010635326 6:78252086-78252108 GATGGTGGAGGACTACAAGATGG - Intergenic
1013637097 6:112039259-112039281 GCTGCTCGTGGGCGCCAAGAAGG - Intergenic
1013747841 6:113366895-113366917 TAGGCTCGTGGGCAACCAGAGGG - Intergenic
1014654434 6:124082133-124082155 CATGGTGGTGGGCAACAGGAAGG + Intronic
1017307365 6:152934719-152934741 GATGCTTGTGGAAGACAAGAAGG - Intergenic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1021018381 7:15564651-15564673 GAGACTGGTGGGCAGGAAGAAGG - Intergenic
1021982567 7:26068901-26068923 GAGGCTGGAGGGCAGGAAGAGGG - Intergenic
1026624200 7:71977977-71977999 GGAGCTGGTGGGCATGAAGAGGG - Intronic
1028825292 7:95265503-95265525 TATGCTGCTGGGTAACTAGAAGG - Intronic
1029695745 7:102212082-102212104 GATGCTTGTGGGATTCAAGATGG + Intronic
1031082380 7:117271319-117271341 GTGGGTGGTGGACAACAAGATGG - Intergenic
1032406105 7:131656906-131656928 GATGCTGGTGGAGAAGAAGAAGG - Intergenic
1033201531 7:139376816-139376838 GATGCTGGTGGGGAGCTAGTAGG + Intronic
1033247420 7:139729519-139729541 GATGCTGAGGGGCATGAAGAGGG - Intronic
1034066457 7:148141423-148141445 GATGCTTGTGGAATACAAGATGG + Intronic
1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG + Intergenic
1042226939 8:66521540-66521562 AATGCTGGTGGGGAACATGTAGG - Intergenic
1042282615 8:67070524-67070546 GATTCTGGTGGCCAACATGGAGG + Intronic
1042540554 8:69903554-69903576 GAGGCTGGTGGGGAAGAGGACGG + Intergenic
1045787526 8:105939235-105939257 TAAGCTGGTGGGCAACTAGATGG - Intergenic
1046550366 8:115708347-115708369 GCTGCTGGTGGGGAAAGAGATGG - Intronic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048295678 8:133211895-133211917 GATTCAGGGGGGCAACCAGATGG + Intronic
1049830773 8:144699636-144699658 GGTGCTGGTGGGCTACGGGACGG + Intergenic
1051169407 9:14304215-14304237 GAGGCTGCTGGGCATGAAGAAGG + Intronic
1051516080 9:17931886-17931908 AGTGCTGATTGGCAACAAGATGG + Intergenic
1051668563 9:19488224-19488246 GAAGCTGGTGGGCAATCACAGGG - Intergenic
1052245764 9:26332157-26332179 GATCCTGGTGGGCAGTAAGTGGG - Intergenic
1055518338 9:77055515-77055537 GATTCTGGTTGGGAAAAAGAAGG - Intergenic
1059696496 9:116734891-116734913 GATGCTGGTGGTATAGAAGATGG - Intronic
1060105442 9:120870077-120870099 GCTGCTGGTGCCCACCAAGATGG + Intronic
1060171989 9:121469394-121469416 GGTGCTAGTTGGCAACAGGATGG + Intergenic
1060811810 9:126614518-126614540 GATGTTGGACGGCATCAAGATGG + Exonic
1062359271 9:136179904-136179926 GATGCGGGAGGGCCCCAAGAAGG - Intergenic
1188702874 X:33286961-33286983 GATGCGGGGGAGCAACAAAATGG + Intronic
1190093916 X:47463694-47463716 GAGGCTGGGGGGCAGCCAGAGGG - Intronic
1192465522 X:71352748-71352770 TCTGCTGGTAGGCACCAAGAGGG + Intergenic
1192509567 X:71713866-71713888 CATGCTGTTGAGGAACAAGACGG - Intergenic
1192517130 X:71767687-71767709 CATGCTGTTGAGGAACAAGACGG + Intergenic
1194648073 X:96482701-96482723 GACCCAGGTGGGCACCAAGAAGG + Intergenic
1195206073 X:102601282-102601304 GAAGATGGTGGGCAATAGGAAGG + Exonic
1196829445 X:119764800-119764822 GATGCTAATAGTCAACAAGATGG + Intergenic
1196944959 X:120814594-120814616 TAAGCTGGTGGCCAACGAGATGG - Intergenic
1199471401 X:148199633-148199655 GAGGCTGTTGGGCAGAAAGAAGG - Intergenic