ID: 948385662

View in Genome Browser
Species Human (GRCh38)
Location 2:237579092-237579114
Sequence TGTTATACACAGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948385655_948385662 18 Left 948385655 2:237579051-237579073 CCAAAATGTTTTGCCCCATTGTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
948385658_948385662 4 Left 948385658 2:237579065-237579087 CCCATTGTGTGTGGCTTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
948385657_948385662 5 Left 948385657 2:237579064-237579086 CCCCATTGTGTGTGGCTTGTCAG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
948385660_948385662 3 Left 948385660 2:237579066-237579088 CCATTGTGTGTGGCTTGTCAGGA 0: 1
1: 0
2: 0
3: 15
4: 156
Right 948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948385662 Original CRISPR TGTTATACACAGAACTGGAG AGG Intronic
907312207 1:53545116-53545138 TGGTTTTCACAGAATTGGAGGGG - Intronic
910729669 1:90380799-90380821 TATTATACAAAGAACTACAGGGG - Intergenic
911529247 1:99024083-99024105 TCTAATACACAGAAATGCAGGGG - Intergenic
916322835 1:163523648-163523670 TGTGCTACAAAGCACTGGAGAGG - Intergenic
917435417 1:175016251-175016273 TGCTATACAAGGAACTGGAGAGG + Intronic
918986932 1:191643198-191643220 TTTTATATACAGAAATGGAAGGG - Intergenic
920421899 1:205840493-205840515 TGTTATATTCAGAGCTGAAGGGG + Intronic
920591483 1:207222968-207222990 TGTTATTCAGAAAAATGGAGGGG - Intergenic
920924938 1:210331962-210331984 TTTTATACACAGAAGTGGGATGG - Intronic
921495498 1:215835720-215835742 TTTTCCACAGAGAACTGGAGAGG - Intronic
921723177 1:218495823-218495845 GGTTTTACACAGAAAGGGAGAGG + Intergenic
921797016 1:219357973-219357995 TGATAAACACAAAACTGTAGAGG + Intergenic
921868926 1:220116378-220116400 TGTTTTTCACAGATGTGGAGAGG + Intronic
1062874913 10:935248-935270 TCCTATACAAAGAAATGGAGAGG + Intergenic
1063257525 10:4344660-4344682 TGTTTTCCACAGAAGTGGCGAGG - Intergenic
1064565966 10:16639525-16639547 ATCTATGCACAGAACTGGAGGGG + Intronic
1066003635 10:31127744-31127766 TGGTATAGACAGAACTGTTGGGG - Intergenic
1067216362 10:44307703-44307725 TGTCATGCACAGATCTGGAGAGG + Intergenic
1067534959 10:47102279-47102301 TGTGATGCACAGCACTGGAGTGG - Intergenic
1067914548 10:50382651-50382673 TATTATAAACAGCAATGGAGAGG + Intronic
1068248077 10:54399249-54399271 TGTTACACACTGAACTTCAGTGG - Intronic
1074628255 10:115218922-115218944 TCTTATACACAGAAGTGAGGTGG - Intronic
1074868557 10:117559534-117559556 TGCTCTACATAGAACTGGAGGGG - Intergenic
1084134973 11:67171190-67171212 TGTGATACATAGAAGTTGAGAGG + Intronic
1084270407 11:68026518-68026540 TGTTGTACTGAGAGCTGGAGGGG - Intronic
1084436439 11:69144291-69144313 TGTTACTCACAGATCTGCAGGGG + Intergenic
1085191742 11:74631899-74631921 AGTTACAAACAGAAGTGGAGGGG - Intronic
1086477510 11:87193183-87193205 AGTGATACACAGCAGTGGAGTGG + Intronic
1092531071 12:9345961-9345983 TAGTATTCAAAGAACTGGAGTGG - Intergenic
1093667210 12:21829082-21829104 TGTTAACCACACAACAGGAGAGG + Intronic
1096401195 12:51307910-51307932 TCTAAAACACAGAAATGGAGCGG - Intronic
1097412806 12:59276320-59276342 TCTAATACAGAGTACTGGAGAGG + Intergenic
1098067300 12:66632237-66632259 TGCTATAAACAGAACTGCATGGG + Intronic
1098802160 12:74974917-74974939 TGTAAAGCACAGAAATGGAGAGG + Intergenic
1099763334 12:86948444-86948466 TGGTGTACACAGAAGTGAAGCGG - Intergenic
1106629025 13:31451380-31451402 TCTTAGAAAGAGAACTGGAGTGG + Intergenic
1108694807 13:52893691-52893713 AGTAAAACACAGATCTGGAGAGG - Intergenic
1112746139 13:102529393-102529415 TGATATACAAAGAACTGCATCGG - Intergenic
1112805335 13:103158721-103158743 TGTTCTACACAGATCTTGATAGG + Intergenic
1114731782 14:25000635-25000657 AGTTTTACACAGAAATGCAGAGG - Intronic
1114731784 14:25000683-25000705 AGTTTTACACAGAAATGCAGAGG + Intronic
1115052124 14:29075288-29075310 TATCATACACTGAAATGGAGAGG + Intergenic
1117247729 14:53902346-53902368 TGCTGTGCACAGAACTGAAGAGG - Intergenic
1117287099 14:54296539-54296561 TGTTATACACATTCCTGGTGAGG - Intergenic
1118036138 14:61869588-61869610 TGTTATACACCCAACTGCTGTGG + Intergenic
1119572196 14:75684863-75684885 TGTTCTATACAGAACTTGAGTGG + Intronic
1119866215 14:77977318-77977340 TGTTATGCAGAGAAGTGGATAGG - Intergenic
1120044687 14:79792852-79792874 TTTTATACACAGAAGTGATGTGG - Intronic
1122156627 14:99753993-99754015 TCTTAGACACAGACCTGGGGTGG - Intronic
1122675532 14:103409864-103409886 TGTTACAAACAGATCTGCAGTGG + Intronic
1123140200 14:106069363-106069385 TGTTAAAAACACAACTGGAATGG - Intergenic
1128787847 15:70411279-70411301 TGTATGACACAGAGCTGGAGAGG + Intergenic
1130568967 15:85023507-85023529 TGGTCTATACAGAACTGGGGAGG + Intronic
1131200884 15:90394774-90394796 TATTATAAATAGAACTGAAGAGG - Intronic
1131295431 15:91144238-91144260 GGTTAAACACAGGACTGGAGTGG + Intronic
1134866635 16:17612977-17612999 TATCATACACAGAGATGGAGAGG + Intergenic
1136044825 16:27607229-27607251 TGTTATACCCAGAACAGGAATGG + Intronic
1141535584 16:84677592-84677614 TATTACACACAGAACGGGGGGGG + Intergenic
1144017902 17:11214063-11214085 TGTTTTACACAGAAAGGCAGAGG - Intergenic
1149862700 17:60132390-60132412 TGTTAGAGACAGAACTCCAGAGG + Intergenic
1153331795 18:3881347-3881369 TGTTAAAGATAGAACTGGAGAGG + Intronic
1155401889 18:25448267-25448289 TGTTATCCACAGAGCTGCTGTGG - Intergenic
1156956473 18:42971032-42971054 TGTTATACAAAGAAGTAAAGTGG - Intronic
1158193052 18:54852759-54852781 TGATATACACACAACTTGAGGGG - Intronic
1159550724 18:69893867-69893889 TATTATACACAGAGCTATAGTGG + Intronic
1159745969 18:72235231-72235253 TGTTGTCCACAGGACTGGAGAGG + Intergenic
1159888286 18:73931220-73931242 TGTAACAGACAGAACAGGAGGGG + Intergenic
1163292828 19:16391869-16391891 TGTAACACACAGCACTGGTGGGG - Intronic
1164917549 19:32064053-32064075 AATTATGCACAGAACTGGATGGG + Intergenic
1165250738 19:34531817-34531839 GGTTAGAAACAGAACTCGAGGGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
925718177 2:6803936-6803958 TGTTTTACCCAGGACTAGAGAGG - Intergenic
929928410 2:46233515-46233537 TGCCATACACAGAGCTGCAGAGG + Intergenic
930370127 2:50491275-50491297 TGTTATATTCAGGATTGGAGAGG + Intronic
930660756 2:54050670-54050692 TGTTTTACCCAGCACTGGAGCGG - Intronic
930663687 2:54081173-54081195 TATTATAAACAGAACTGAGGAGG - Intronic
931413318 2:62056325-62056347 TCTTATGCACAGAAGTGAAGTGG + Intronic
933982811 2:87567286-87567308 TGTGACAGACAGAGCTGGAGCGG - Intergenic
935586507 2:104804444-104804466 TTTCATACACAGAAGAGGAGAGG - Intergenic
936311028 2:111383507-111383529 TGTGACAGACAGAGCTGGAGCGG + Intergenic
941789527 2:169536298-169536320 TGTCGTAGACAGAACTAGAGAGG - Intronic
942698866 2:178680180-178680202 TTTCACACACAGAACTGAAGAGG + Intronic
948385662 2:237579092-237579114 TGTTATACACAGAACTGGAGAGG + Intronic
1175141527 20:56864349-56864371 TGTTCTACATGGGACTGGAGAGG + Intergenic
1176755715 21:10724164-10724186 TGTTATGCAGTGAAGTGGAGTGG - Intergenic
1178047537 21:28712149-28712171 TGTTATACACAGCCTTTGAGAGG + Intergenic
1178427526 21:32491056-32491078 AGCAATACACAGAACAGGAGAGG + Intronic
1203291345 22_KI270735v1_random:41901-41923 TGGAATACAGAGAACTGGAATGG - Intergenic
950758489 3:15198637-15198659 TCTTATACACAGAAGTGAGGTGG - Intergenic
958994855 3:100892617-100892639 TGTTCTACAGAGAACAGAAGTGG - Intronic
960198794 3:114805639-114805661 AGTTATACACATAACAAGAGTGG - Intronic
961517852 3:127449562-127449584 GGTTTTAAACAGAACTAGAGAGG - Intergenic
962434671 3:135355400-135355422 TGTTAAACAGAGATCTTGAGTGG + Intergenic
965011155 3:163093850-163093872 TGTAATACACACATCTGCAGAGG - Intergenic
965287391 3:166834175-166834197 TGATATACAAAGAACTGCACAGG + Intergenic
965903834 3:173678002-173678024 TGCCACACACAGAACTGGACAGG - Intronic
966929490 3:184666625-184666647 TGTCATACACAGAAGAGGATGGG + Intronic
970364125 4:15341622-15341644 TGGTGTAGACAGAAGTGGAGGGG - Intronic
970530192 4:16974018-16974040 TGCCATGCACAGAGCTGGAGTGG + Intergenic
970633248 4:17978337-17978359 TGTAATACCAAGAACTTGAGAGG + Intronic
971058830 4:22943966-22943988 TGTTATATAGAGAAATAGAGAGG + Intergenic
979288878 4:118957969-118957991 TGTTCTCCACATAAGTGGAGGGG - Intronic
980728644 4:136798852-136798874 AGTTATACATAGAACTGAAATGG + Intergenic
981245174 4:142527734-142527756 TGTAATACTCAGATCTGTAGGGG + Intronic
982301865 4:153887314-153887336 TGTCAGACCCAGAACTGGAGTGG - Intergenic
984816961 4:183847947-183847969 TGGTATAAAGAGAACTAGAGAGG + Intergenic
985325076 4:188757850-188757872 TGTTATACATATAACTGAGGGGG + Intergenic
987071505 5:14341155-14341177 TGCCATACACAGGACTGAAGGGG - Intronic
988699345 5:33657918-33657940 TCTAATCCAGAGAACTGGAGTGG + Intronic
991627404 5:68618190-68618212 TGTTCTACAGAGGAGTGGAGTGG - Intergenic
992417729 5:76567990-76568012 AGTAATATACAGGACTGGAGCGG + Intronic
992552511 5:77872267-77872289 TGTTCTCCACAGAGCTGTAGTGG + Intergenic
993186698 5:84630910-84630932 AGTTATCTACAGAACTAGAGGGG - Intergenic
993880396 5:93353832-93353854 TGATATAAAAAGATCTGGAGCGG + Intergenic
993969821 5:94405770-94405792 TGGTATACACAGGACTAGACGGG + Intronic
998365934 5:141631162-141631184 TGTGAAAAACAGAACTGTAGGGG + Intronic
998420680 5:141982748-141982770 TTTTTTACACAGAATTGAAGAGG + Intronic
1004331823 6:14728801-14728823 TGAGATAAACAGATCTGGAGGGG + Intergenic
1006773843 6:36576722-36576744 TGTGAGACACAGGACTGTAGAGG - Intergenic
1009047378 6:58247602-58247624 TGTAATATCCAGAAGTGGAGAGG + Intergenic
1009367558 6:62867583-62867605 TGTAATATCCAGAACGGGAGAGG - Intergenic
1009689407 6:67009063-67009085 TGTTATATTCAAAACTGGATGGG + Intergenic
1009692143 6:67048909-67048931 TGGTATAAAGAGATCTGGAGTGG - Intergenic
1010784236 6:79981571-79981593 TGTTTCACACAGACCTTGAGAGG - Intergenic
1014277995 6:119408476-119408498 TTTTATAAACAGAAATGAAGAGG + Intergenic
1015335237 6:132029365-132029387 AGTTATAGACAGAAATGGGGAGG - Intergenic
1015832877 6:137388652-137388674 TATTATACACAGTACTGATGAGG - Intergenic
1017701180 6:157073920-157073942 TGCTACACACACAAGTGGAGTGG + Intronic
1019001181 6:168753775-168753797 TGTAAGACCCAGTACTGGAGAGG + Intergenic
1021838937 7:24706668-24706690 GGTTACACACAGAACTGGGGAGG + Intronic
1025605297 7:63035866-63035888 TGTCATACAAAGAGCTGTAGAGG - Intergenic
1025740483 7:64192176-64192198 TGTCATACACAGACCTGGCAGGG + Intronic
1027240232 7:76322619-76322641 TGTTATCCAGAGTATTGGAGAGG - Intergenic
1028021034 7:85773279-85773301 TGTCATACACAGAAATGAAGGGG - Intergenic
1028115847 7:86996650-86996672 TGCTATACAGAGAACAGAAGTGG + Intronic
1028417867 7:90598187-90598209 TATTTAACACAAAACTGGAGGGG - Intronic
1031164447 7:118212474-118212496 TGTAATCCCCAGTACTGGAGGGG + Intergenic
1036826201 8:11978043-11978065 TGTTATTCACAGATCCAGAGAGG + Intergenic
1039076615 8:33695599-33695621 TGTCATACACAGACTTGGAGAGG + Intergenic
1040702267 8:50080845-50080867 TGTAATGCCCAGAACTTGAGTGG - Intronic
1045099044 8:98826266-98826288 AATTATAAACAGAACTAGAGAGG - Intronic
1045310417 8:100996340-100996362 TGTTATAGACAGGCCTGGTGTGG - Intergenic
1048193530 8:132311952-132311974 CGTTATAAACAGAAGAGGAGAGG + Intronic
1049908467 9:242324-242346 TGTTTTACAGAGAAGTGGAAAGG + Intronic
1050550380 9:6744048-6744070 TTTTTTACATAGAACTGGAGAGG - Intronic
1051688061 9:19679386-19679408 TGTCTTACACAGTACTGGGGAGG + Intronic
1052371477 9:27670118-27670140 TTTTAGACAGAGAATTGGAGGGG - Intergenic
1185934456 X:4239949-4239971 TGTCATGCACAGAAGAGGAGTGG + Intergenic
1189020166 X:37327813-37327835 TGTTTTACATTGAAGTGGAGAGG + Intergenic
1193451069 X:81667943-81667965 TGTTATAAACAAAACTGGAAGGG - Intergenic