ID: 948387629

View in Genome Browser
Species Human (GRCh38)
Location 2:237591463-237591485
Sequence GGGCGGAGGAACCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948387629_948387643 7 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387643 2:237591493-237591515 GTGGGGGGCTCTTATGCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 110
948387629_948387638 -8 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387638 2:237591478-237591500 CTCCGCCCTGTGGGAGTGGGGGG 0: 1
1: 0
2: 3
3: 15
4: 255
948387629_948387637 -9 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387637 2:237591477-237591499 CCTCCGCCCTGTGGGAGTGGGGG 0: 1
1: 0
2: 2
3: 20
4: 210
948387629_948387642 4 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387642 2:237591490-237591512 GGAGTGGGGGGCTCTTATGCTGG 0: 1
1: 0
2: 2
3: 10
4: 138
948387629_948387648 18 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387648 2:237591504-237591526 TTATGCTGGAGGGGGGACACTGG 0: 1
1: 0
2: 0
3: 10
4: 129
948387629_948387644 8 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387644 2:237591494-237591516 TGGGGGGCTCTTATGCTGGAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
948387629_948387647 11 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387647 2:237591497-237591519 GGGGCTCTTATGCTGGAGGGGGG 0: 1
1: 0
2: 2
3: 10
4: 208
948387629_948387645 9 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387645 2:237591495-237591517 GGGGGGCTCTTATGCTGGAGGGG 0: 1
1: 0
2: 3
3: 16
4: 140
948387629_948387635 -10 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387635 2:237591476-237591498 TCCTCCGCCCTGTGGGAGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 168
948387629_948387649 23 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387649 2:237591509-237591531 CTGGAGGGGGGACACTGGCCTGG 0: 1
1: 0
2: 3
3: 41
4: 406
948387629_948387646 10 Left 948387629 2:237591463-237591485 CCACCACAGTGGTTCCTCCGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 948387646 2:237591496-237591518 GGGGGCTCTTATGCTGGAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948387629 Original CRISPR GGGCGGAGGAACCACTGTGG TGG (reversed) Intronic
900092059 1:924938-924960 GGGCGGCGGCACCTTTGTGGCGG - Intronic
901512008 1:9722167-9722189 GGTGGGAGGAACCCTTGTGGCGG - Intronic
901660242 1:10794611-10794633 GGGCAGAGGAACTTGTGTGGAGG + Intronic
904757063 1:32773754-32773776 GGGCTGAGCAAGCACTGAGGAGG + Exonic
904825724 1:33272605-33272627 GGGCAGAGGAAACACGCTGGTGG - Intronic
904872083 1:33625241-33625263 GGTTCGAGGAACCGCTGTGGGGG + Exonic
905450113 1:38050886-38050908 GGGCAGAGGCCCCACTGGGGAGG - Intergenic
905665133 1:39758979-39759001 GGGAGGTGGAACCACTCTGCCGG + Exonic
905933199 1:41804225-41804247 GGGCTGTGGGACCACTGGGGAGG - Intronic
906673457 1:47676753-47676775 GGGCGGAGAGGCCAATGTGGAGG - Intergenic
912246280 1:107964930-107964952 GCGCGGAGGAACCGCGGCGGCGG - Exonic
915805007 1:158838853-158838875 GGGCTGAGGAACCCCTCTAGTGG + Intronic
916422128 1:164647278-164647300 TGGAGGAGGAACCACTAGGGAGG + Intronic
916730983 1:167566614-167566636 GGGTGGAAGAACAGCTGTGGAGG + Intergenic
919988076 1:202689650-202689672 GGGGGCAGGGAACACTGTGGGGG + Intronic
922966595 1:229696043-229696065 GGGCAGAGGAACAAGTGTGCGGG + Intergenic
923940181 1:238813982-238814004 GATTGGAGGTACCACTGTGGAGG + Intergenic
1063814374 10:9755993-9756015 GGGCGCTGGTACAACTGTGGTGG + Intergenic
1067192396 10:44082416-44082438 GGGCAGAGGAAACACTTTGGAGG - Intergenic
1072415529 10:95243646-95243668 GGGCTGAGAAAACACAGTGGTGG - Intronic
1075254867 10:120917659-120917681 GGGTGGAGGAGCCACTCTGGAGG + Intergenic
1075674429 10:124286517-124286539 GGGAGGAGGAGCCCCTGGGGTGG + Intergenic
1076705134 10:132297298-132297320 GGGCGGAGGCACCGGTGGGGTGG - Intronic
1076729433 10:132431096-132431118 GGGAGGAGGAGCCCCTGGGGAGG - Intergenic
1077560238 11:3255968-3255990 GGGTGGAGGCTCCACTCTGGGGG - Intergenic
1077566135 11:3301784-3301806 GGGTGGAGGCTCCACTCTGGGGG - Intergenic
1079651782 11:22938897-22938919 GAGGGGAAGAACCACTATGGTGG + Intergenic
1081639671 11:44744159-44744181 GGGAGGAGGCCCCACTGTGGAGG - Intronic
1081673538 11:44955197-44955219 GGGGGCAGGAAGCACTGGGGAGG - Intergenic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1084111083 11:67014629-67014651 GGGCTGAGGGATCACAGTGGAGG + Intronic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1084677807 11:70646498-70646520 GGGTGGAGCAACCACTTTGCAGG + Intronic
1084948057 11:72649616-72649638 GGGCAGAGGAAGCAGTCTGGAGG - Intronic
1085698233 11:78723710-78723732 GGGCAGAGGATCCAGTTTGGAGG - Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1096487145 12:51990951-51990973 GGACAGAGGAACCCCTGTGAAGG - Intronic
1101054796 12:100901353-100901375 GGGCTTAGGAACTACTGTTGGGG - Intronic
1104474014 12:129055282-129055304 GGGTGGATGATCCTCTGTGGGGG - Intergenic
1105797363 13:23868561-23868583 GGGAGGAGGAGGCATTGTGGTGG - Intronic
1106079940 13:26492006-26492028 GTGGGGAGGAGCCATTGTGGGGG - Intergenic
1106460664 13:29964854-29964876 GGCAGGAGGAACCCCTCTGGTGG + Intergenic
1110832771 13:80050552-80050574 GGAGAGAGGAACCACTGAGGAGG - Intergenic
1113513540 13:110873525-110873547 GGGCGGAGAGGCCACTGGGGAGG - Intergenic
1118621672 14:67619833-67619855 GGGCGGCGGGGCCAATGTGGCGG + Exonic
1122230340 14:100303795-100303817 GTGGGGAGGAACCACTGTCCTGG + Intronic
1122652147 14:103231893-103231915 TGGCAGAGGAACCTCTGGGGTGG + Intergenic
1124473223 15:30007400-30007422 GGGCACAGGAACCACTCTTGTGG + Intergenic
1124501067 15:30226175-30226197 GGGCGTAGGGGCCACGGTGGGGG - Intergenic
1124742502 15:32312492-32312514 GGGCGTAGGGGCCACGGTGGGGG + Intergenic
1126349443 15:47729432-47729454 GGGCCAAGGGACCACTTTGGAGG + Intronic
1126425555 15:48523715-48523737 GGGGGGGGGAACCGTTGTGGTGG + Intronic
1132648446 16:1009806-1009828 TGGCGGAGGAGCAAGTGTGGGGG + Intergenic
1133322207 16:4921366-4921388 GAGCAGAGGAACCACTAGGGAGG + Intronic
1138228968 16:55324148-55324170 GGGCGGAGGAACCGGGCTGGAGG + Exonic
1141756759 16:85996617-85996639 GGGCAGGAGAGCCACTGTGGGGG - Intergenic
1141987093 16:87587231-87587253 GGGAGGAGTGACCTCTGTGGCGG + Intergenic
1142156694 16:88535576-88535598 GGGAGGATGAAGCCCTGTGGTGG + Exonic
1142982619 17:3680555-3680577 GGGTGGAGGAAGCAGGGTGGAGG - Intronic
1146625939 17:34435389-34435411 GGGTGGAGGAAGAGCTGTGGAGG - Intergenic
1146654615 17:34627705-34627727 GGGCTGAGGAAGCATTTTGGTGG - Intronic
1150448536 17:65246344-65246366 AGGAGGAGGAAGCAGTGTGGGGG + Intergenic
1152448110 17:80358234-80358256 GGTCAGAGGAACCAGAGTGGCGG - Intronic
1152745478 17:82036824-82036846 GGGCGGAGGAACCTCAGGGAGGG - Intronic
1152754465 17:82081462-82081484 GGGCGCAGGTGTCACTGTGGTGG - Intronic
1152801677 17:82333658-82333680 GGGCGGGGGAACCAGAGGGGCGG - Intronic
1152871043 17:82752973-82752995 GGGTGTAGGTACCCCTGTGGAGG + Intronic
1157271767 18:46281745-46281767 GGGTGGAGTAACCATTGTGCTGG - Intergenic
1159023989 18:63166248-63166270 GGGAGAAGGATCCGCTGTGGAGG + Intronic
1160300923 18:77677666-77677688 GGGCTAAGGAGCCACTGGGGTGG + Intergenic
1161069028 19:2251338-2251360 GGGCGCAGGATCCCCGGTGGTGG - Exonic
1161296500 19:3523078-3523100 GGGAGGGGGAGCCACAGTGGTGG - Intronic
1161321342 19:3643070-3643092 GGGCGGAGCATCCAATGTGTGGG - Intronic
1163255456 19:16153338-16153360 GGGCAGAGGGACTACTGGGGTGG - Intronic
1166041420 19:40205091-40205113 GGGAGGAGGAAGGACAGTGGTGG - Intronic
1166852157 19:45766198-45766220 GGGCGGAGGGAGCCTTGTGGTGG + Intronic
1167593642 19:50416863-50416885 GGGCCGAGGACCCTCTGTGGGGG - Intronic
1168335138 19:55593097-55593119 GGGCGAAGGCACCGCTGCGGAGG - Exonic
1168509934 19:56966324-56966346 GGGCTGAGGAACCAGAGTGAAGG - Intergenic
926104603 2:10142405-10142427 GGGAAGAGGGGCCACTGTGGAGG + Intronic
931846954 2:66213860-66213882 GGGATGAGGAAGCACTATGGAGG + Intergenic
933789927 2:85875700-85875722 GGGCGGAGAAAACAGAGTGGAGG + Intronic
937137324 2:119565145-119565167 GGAAGGAGGAAGTACTGTGGTGG - Intronic
937211586 2:120276134-120276156 GGGAGGTGGAACCACCATGGTGG + Intronic
938036565 2:128039648-128039670 TGGCTGAGGGACCACTCTGGAGG + Intergenic
938100275 2:128493452-128493474 GGGCGGGGGCTCCACTCTGGGGG + Intergenic
947252469 2:228123058-228123080 GGGAGGTGGAACCAGTGTAGGGG - Intronic
947361997 2:229355083-229355105 GGGCAGAGAAACGGCTGTGGTGG + Intergenic
948387629 2:237591463-237591485 GGGCGGAGGAACCACTGTGGTGG - Intronic
948600802 2:239106554-239106576 GCGGGGAGGAGCCACTGTAGAGG - Intronic
1169119028 20:3084388-3084410 GGGCAGAGGAGCCAATGGGGTGG - Intronic
1173128219 20:40360373-40360395 GATCTGAGGAAACACTGTGGGGG + Intergenic
1175409042 20:58754024-58754046 GGGCGGAGCAACGTGTGTGGCGG - Intergenic
1176266403 20:64211802-64211824 GGAGGGAGGGACCACAGTGGTGG + Intronic
1179969631 21:44827534-44827556 GGGAGGAGCCACCACTGTGGCGG + Intergenic
1180183089 21:46126646-46126668 GGGCGGCGGAGCCACTGCGGAGG + Intronic
1182480733 22:30607142-30607164 GGGCGGGGGAAGGTCTGTGGTGG - Exonic
1182880807 22:33731554-33731576 GGGGGGAGGAAGAAATGTGGAGG + Intronic
1183629726 22:39025821-39025843 GGGGGGAGGCACCAAGGTGGAGG - Intronic
1184413372 22:44338377-44338399 GGCAGGAGGAAGCACTTTGGTGG + Intergenic
1185233973 22:49700344-49700366 GGGCTGAGGACACACTGAGGAGG - Intergenic
951857823 3:27217511-27217533 GGGCGGATGTCCCACTTTGGTGG - Intronic
952546387 3:34424379-34424401 AGGAGAAGGAACCACTGGGGAGG - Intergenic
953783754 3:45895018-45895040 GTGGGAAGGATCCACTGTGGGGG + Intronic
967680439 3:192356172-192356194 GGGAGGAGGAAGCAGAGTGGTGG - Intronic
967807311 3:193727401-193727423 GGGTGGAGCAAACACTTTGGAGG + Intergenic
968471525 4:784733-784755 GGGTGGAAGAACCACCCTGGGGG + Intergenic
968652191 4:1764714-1764736 GGGTGGGGGATCCCCTGTGGGGG - Intergenic
968982533 4:3858122-3858144 GGGTGGAGGAAACACTGTACTGG - Intergenic
976402743 4:84625553-84625575 AGGCGGAGGAACAGCTGTGCAGG + Intronic
980583655 4:134786547-134786569 GGGGGTAGGACCCACTGAGGTGG + Intergenic
982081939 4:151798738-151798760 GGCCAGAGGTACCACTTTGGAGG + Intergenic
983066249 4:163212947-163212969 GGGGGGAGGAACCAAGATGGCGG - Intergenic
985485543 5:146361-146383 GAGAGGAGGAACCACTGTGGGGG - Intronic
989366129 5:40658015-40658037 GGTCAGAGGAAGAACTGTGGTGG + Intergenic
995072645 5:107942207-107942229 GAGCTGAGGAACCATGGTGGTGG - Intronic
995476633 5:112554762-112554784 GGCCAGAGACACCACTGTGGTGG + Intergenic
998872435 5:146565989-146566011 GGGCGGGGGAAACACTGTTAAGG + Intergenic
999693736 5:154170426-154170448 TGGCTGAGGAACAACTGCGGTGG + Intronic
1001936729 5:175710678-175710700 TGGAGGAGGAACATCTGTGGTGG + Intergenic
1002642514 5:180636960-180636982 GGGGGGAGGAGCTCCTGTGGGGG - Intronic
1006986583 6:38179612-38179634 GGGCAGAGGCACCTCTGTGCAGG + Intronic
1014502133 6:122204463-122204485 AGGCAGAGAAACCACTGAGGAGG - Intergenic
1014794486 6:125708340-125708362 GGGGGAAGGAAACACTGGGGAGG + Intergenic
1018626955 6:165789046-165789068 GGGCAGAGCATCCTCTGTGGGGG + Intronic
1019045167 6:169139888-169139910 GGGGGAAGGAACCACTATGGAGG + Intergenic
1019531622 7:1506360-1506382 GGGCAGAGGAAGCTCTGTGCAGG - Intergenic
1019759620 7:2800834-2800856 CGGAGGAGGAATCACAGTGGGGG - Intronic
1020418142 7:7969218-7969240 GGGCGGGGGTATCGCTGTGGGGG - Exonic
1021597140 7:22329450-22329472 GGGAGGAGGAACCAGAGTGGGGG - Intronic
1023347788 7:39289129-39289151 GGGAGGAGGAACCAATGAGGAGG - Intronic
1032084404 7:128876550-128876572 GGGCTGAGGAACCACGGAGAAGG - Intronic
1034352670 7:150427566-150427588 GGGGGGAGGAGCCATTATGGTGG + Intergenic
1034466248 7:151231660-151231682 TGGTTGGGGAACCACTGTGGTGG + Intergenic
1034808436 7:154108755-154108777 GGGCTGGGGAGCCACTGGGGCGG + Intronic
1035421006 7:158729238-158729260 GGGGGGAGGAGCAAATGTGGAGG + Intergenic
1035421122 7:158729674-158729696 GGGGGGAGGAGCAAGTGTGGAGG + Intergenic
1035421132 7:158729703-158729725 GGGGGGAGGAGCAAGTGTGGAGG + Intergenic
1035421141 7:158729731-158729753 GGGGGGAGGAGCAAGTGTGGAGG + Intergenic
1035691045 8:1559971-1559993 GGGTGGAGAAGCCAGTGTGGAGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041304839 8:56447585-56447607 GGGCCGAGGGCACACTGTGGAGG + Intergenic
1052067039 9:24034682-24034704 GGTTGGAGGAACCACACTGGAGG + Intergenic
1056846142 9:90039846-90039868 AGGTACAGGAACCACTGTGGTGG + Intergenic
1059313080 9:113401516-113401538 GGGCGCAGGAACCGCTTGGGAGG + Intergenic
1060583185 9:124770520-124770542 GGGAGGAGGAACCCCTGTAGGGG + Intronic
1060656138 9:125374099-125374121 GGCAGGAGGAAGGACTGTGGGGG - Intergenic
1061216343 9:129224134-129224156 GGGCCCAGGGACCGCTGTGGGGG - Intergenic
1185466624 X:358808-358830 GGGGGGCGGCACCACGGTGGGGG + Intronic
1195466317 X:105183146-105183168 GGCAGGATGACCCACTGTGGTGG + Intronic