ID: 948388786

View in Genome Browser
Species Human (GRCh38)
Location 2:237597781-237597803
Sequence CCTCCATCCAGGCCACCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 1, 2: 2, 3: 46, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948388780_948388786 22 Left 948388780 2:237597736-237597758 CCACAGATGAAAAACACGGACCG 0: 1
1: 0
2: 1
3: 10
4: 75
Right 948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG 0: 1
1: 1
2: 2
3: 46
4: 323
948388782_948388786 2 Left 948388782 2:237597756-237597778 CCGACAGACGATGCTTGGACACA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG 0: 1
1: 1
2: 2
3: 46
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948388786 Original CRISPR CCTCCATCCAGGCCACCCTC CGG Intronic
900172925 1:1278983-1279005 CCTCCTTCCAGGCACCCCGCTGG - Intergenic
900238356 1:1603160-1603182 CCTCTAGGCAGGCCGCCCTCTGG + Intergenic
900412470 1:2519034-2519056 CCACCCTCCAGGCCTCCCTGGGG + Intronic
900414200 1:2527661-2527683 CTTCCACCCAGGCCTCCCTGGGG - Intergenic
901002177 1:6154353-6154375 CCTCCCTCCAGGCCCACGTCGGG + Intronic
901461119 1:9392477-9392499 CCTCAGGCCAGGCCACCCCCAGG + Intergenic
901511801 1:9721353-9721375 CCTCCTGCCTGGCCTCCCTCTGG + Intronic
901629663 1:10641958-10641980 CCACCCTCCAGGCCACGCTCCGG - Intronic
901730106 1:11273152-11273174 CCGCCCTCCAGCCCACCCTCCGG + Intergenic
901808106 1:11750394-11750416 CCTCCCTTCAGGGCACCCACTGG + Exonic
902288431 1:15421490-15421512 GCTCCATCCAGGGCAGGCTCTGG - Intronic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
904420774 1:30389809-30389831 CCTCCCTCCAGGCTCCCCTGTGG - Intergenic
905211616 1:36378241-36378263 CCTCCATCCTGGCTAGGCTCTGG - Intronic
905417472 1:37814080-37814102 CCTCCATCTCTGCCCCCCTCTGG - Exonic
906666575 1:47626382-47626404 CATCCATCCATGACACCCCCTGG + Intergenic
906804143 1:48763830-48763852 CATCCATCCATGCAACTCTCAGG + Intronic
907193168 1:52665521-52665543 CCTCCAACCAGCCCTCCCTGGGG + Intronic
907328303 1:53655085-53655107 CCTCCTGCCTGGCCAGCCTCTGG - Intronic
907459575 1:54597371-54597393 TCTCCATCCAGGCCATGATCTGG - Exonic
912556958 1:110523528-110523550 CCTCCCTCCAGGCCACCATGTGG + Intergenic
912802734 1:112730705-112730727 CCTCAATCCAGGCAACTGTCTGG - Intergenic
915590207 1:156866413-156866435 CCTCCTTCCGGGCCCTCCTCAGG - Intronic
915955898 1:160219653-160219675 CCTCAATCTCAGCCACCCTCTGG + Intronic
916364419 1:164008325-164008347 CCTGCCTCCATACCACCCTCAGG - Intergenic
919527962 1:198678633-198678655 CCTCCATGCCAGCCAGCCTCTGG + Intronic
920108994 1:203574002-203574024 CCTCCTACCACCCCACCCTCCGG + Intergenic
920243442 1:204570584-204570606 ACTCCATCTGGACCACCCTCTGG + Intergenic
920315973 1:205075836-205075858 CATCCCTCCTGGCCCCCCTCTGG + Exonic
921188056 1:212686564-212686586 CCAGCATGGAGGCCACCCTCAGG - Exonic
921894029 1:220380269-220380291 CCTCCCACCAGGCCCCTCTCAGG - Intergenic
922050968 1:221990400-221990422 CCTCCCACCAGGGCTCCCTCAGG + Intergenic
922820589 1:228482735-228482757 CTTCCATCCAGGACCCTCTCTGG - Intergenic
924810885 1:247400922-247400944 TCTCCCTCCAGACCACCCTCGGG - Intergenic
1064213890 10:13383578-13383600 CCCCCACCCCGGCCACTCTCAGG - Intergenic
1064352120 10:14585946-14585968 CCTGCATACAAGGCACCCTCAGG + Intronic
1064864743 10:19866988-19867010 CCTCTATCCAGGTGACCCTCAGG + Intronic
1067070166 10:43125333-43125355 CCTCCAGCCGGACCCCCCTCTGG - Intronic
1067429137 10:46231356-46231378 CCTCCACCCTGGCCACCCACAGG - Intergenic
1069709544 10:70479648-70479670 CAACCATCCCGGCCACCTTCAGG - Intronic
1069806025 10:71125584-71125606 CCTGCTTCCAGGGCAGCCTCAGG - Intergenic
1070787258 10:79169132-79169154 CCTCCATCTGGCCCACCCTCAGG + Intronic
1070917794 10:80165978-80166000 ACGCCATCCAGGCCTCCTTCTGG + Intronic
1071277114 10:84065497-84065519 CCTTCATCCAGGCCAAACTGGGG + Intergenic
1072618674 10:97066050-97066072 ACGCCATCCAGGCCATCCCCAGG - Exonic
1072664428 10:97383582-97383604 CCTCCATGCAGGTCACCAACTGG + Intronic
1073104856 10:101026775-101026797 CCTCCCCCCAGGCTGCCCTCGGG - Intronic
1074775779 10:116767267-116767289 CCTTCTTCCAGGCAGCCCTCTGG - Intergenic
1074887421 10:117705108-117705130 CCTCCATCCAGGACACACTGGGG + Intergenic
1075250252 10:120862773-120862795 TCCCCATCCAAGCCTCCCTCAGG + Exonic
1076373920 10:129971386-129971408 CGGCCATCCGGGCCGCCCTCGGG + Intergenic
1076635533 10:131880035-131880057 CCTCCCTGCAGACCAGCCTCCGG - Intergenic
1077081122 11:725163-725185 CCGGAATCCAGGCCACCCACTGG + Intronic
1077352670 11:2100106-2100128 CCCCCACCCAGGCCAGCCTCAGG - Intergenic
1077435016 11:2534738-2534760 CCACCACCCAGGCCACTCTGAGG + Intronic
1077492589 11:2868971-2868993 CCTCCCTCCAGGGCCCCCTCTGG - Intergenic
1078011593 11:7576696-7576718 CCACCAGCCAGGGCACCCTGGGG - Intronic
1079025997 11:16948161-16948183 CCTCCACCCACCCCAGCCTCTGG - Intronic
1079096997 11:17517423-17517445 CCTCCATCCAGGTCATCTGCGGG + Intronic
1079453466 11:20617614-20617636 CCTCCACCCACCCCACCATCAGG - Intronic
1080416953 11:32077789-32077811 CCTCTATCCAGGCCACCCTCTGG + Intronic
1081604833 11:44520583-44520605 CCTCCACCCAGGCGTCCTTCGGG - Intergenic
1081868200 11:46371291-46371313 CATCCATCCTGTCTACCCTCAGG + Exonic
1081965174 11:47165029-47165051 ACTCCTTCCAGGCCTCCCCCTGG + Exonic
1082010921 11:47449094-47449116 TCTCCATCCAGGCCCCATTCCGG - Exonic
1082095448 11:48126012-48126034 CCTCCAACTAACCCACCCTCTGG - Intronic
1083308240 11:61771818-61771840 CCTCCCTCCAGGCCTCCTGCAGG + Exonic
1083938524 11:65882852-65882874 CCTGGATCCAGGCCACCTTCTGG - Exonic
1084161422 11:67352596-67352618 CCTCCATCCATTTCTCCCTCAGG + Intronic
1084342493 11:68515333-68515355 ACTCCATCCAGAACATCCTCAGG + Intronic
1084356785 11:68644191-68644213 ACTCCATCCAGAACATCCTCAGG + Intergenic
1088590662 11:111399936-111399958 CCTCTATCCAGGCCATACTTAGG - Intronic
1089200571 11:116722483-116722505 CCTCCATCCAGGCCTCCTCCAGG + Intergenic
1089295803 11:117466989-117467011 CCTCCATCCAGGGCTCATTCGGG - Intronic
1089700035 11:120239240-120239262 CTTCCATGCAGGCCATCCTGTGG + Intronic
1090608708 11:128451366-128451388 CTTCCATCCACCCCACCCACCGG - Intergenic
1090670542 11:128942283-128942305 CCTCCATACAGGCTTCCCTAGGG + Intronic
1091306932 11:134542246-134542268 CATTGATCCAGGCCACACTCAGG - Intergenic
1094433793 12:30398984-30399006 CCTGCACCCAGGCCTCCCTGGGG + Intergenic
1096586813 12:52628276-52628298 CCTGAACCCAGCCCACCCTCAGG + Intergenic
1096614906 12:52826728-52826750 CCTCCATGGTGGCCTCCCTCTGG - Intronic
1101877246 12:108603889-108603911 CCTCCCTGCATGCCAGCCTCTGG + Intergenic
1102132498 12:110542968-110542990 CCTCCTTCCAGGCCTCCCTGGGG + Intronic
1102558637 12:113746540-113746562 TCTCCCTCCAGCCCTCCCTCTGG + Intergenic
1103060037 12:117851228-117851250 CCTCCACATAGGCCTCCCTCTGG - Intronic
1103084685 12:118053259-118053281 CCTCCCTGCAGGCCACACTCTGG + Intronic
1103506103 12:121443123-121443145 CCTCCCTCCAGCCCCTCCTCTGG - Intronic
1103607623 12:122098834-122098856 CCTCCTCCCAGCCCACCCCCAGG - Intronic
1104019545 12:124982458-124982480 CCTCCCTCCAGGGCCCCCTAGGG - Intronic
1104272305 12:127293363-127293385 TCTCCATCCATTCCAGCCTCAGG + Intergenic
1106032466 13:26015789-26015811 GCTCCCTCCAGGCCCCCATCAGG + Intronic
1107550557 13:41470600-41470622 CCTTCTACCAGGCCACTCTCAGG + Exonic
1109683565 13:65784285-65784307 GCTCCATCCCGGCCTCCCTCCGG + Intergenic
1113511850 13:110862795-110862817 CCACCATCCCACCCACCCTCAGG + Intergenic
1113812317 13:113150150-113150172 CCTGCATCCAGGCCACAGCCTGG + Intergenic
1113896181 13:113765977-113765999 CCTGCCTCCAGGCCCACCTCAGG - Intronic
1114224033 14:20722618-20722640 CCTCCTTCCAAGCCACACTGAGG + Intergenic
1114503911 14:23193474-23193496 CCTCCATTCTGCCCTCCCTCTGG - Intronic
1117424319 14:55579892-55579914 CCTCCCTCCAGGGCACCACCTGG - Intronic
1119415817 14:74468503-74468525 CCTTTATCCTGGCCACCCTCTGG + Intergenic
1119895261 14:78214529-78214551 CCTCCATGCCGGACACACTCGGG + Intergenic
1122058593 14:99121751-99121773 CCTTCCTCCAGGTCACCCTGCGG + Intergenic
1122079526 14:99257301-99257323 CCACCATCCAGGTGACCTTCAGG - Intronic
1122204326 14:100141142-100141164 TCTCCAGCCAGGGCACCCACAGG + Intronic
1122276465 14:100593236-100593258 CCTCCACCCCGACCACCCACAGG + Intergenic
1122623165 14:103071109-103071131 CCTCCCTCCCGGCCTCCATCAGG - Intergenic
1122649772 14:103220196-103220218 CCTCCAGCCAGGCCATCTCCAGG - Intergenic
1122857317 14:104566069-104566091 CCTCCACCCGGCCCACCCTCAGG + Intronic
1122885493 14:104708618-104708640 CCGCCTGCCTGGCCACCCTCCGG + Intronic
1125019623 15:34971842-34971864 CCTCCACCCACCCAACCCTCTGG + Intergenic
1127545837 15:59993961-59993983 CCACCACCTGGGCCACCCTCAGG - Intergenic
1127707244 15:61559457-61559479 CTCCCAGCCAGGCCAGCCTCAGG + Intergenic
1128065181 15:64760099-64760121 CCTCCTTCCAGGGCACACACAGG + Intronic
1128774413 15:70308753-70308775 TCTCTATCCAAGCCACCCACAGG + Intergenic
1129717904 15:77862634-77862656 CCTCTCTCCTGGCCACCCCCTGG - Intergenic
1131300201 15:91192886-91192908 CATCCATCCAGGCCAGCCTCAGG - Intronic
1132426754 15:101724381-101724403 CCGCCATCGCGGCCTCCCTCAGG + Exonic
1132602276 16:778662-778684 CCTGCAGCAAGGCCAGCCTCTGG + Exonic
1132730395 16:1358144-1358166 CCTCCAGCCAGGCCAGCCCCAGG - Intronic
1135017610 16:18936865-18936887 GCTCCATGCAGGTCACTCTCTGG - Intergenic
1136078896 16:27838742-27838764 GCATAATCCAGGCCACCCTCAGG + Intronic
1137056720 16:35749610-35749632 CCTCCATCCAGGCCCCAGCCAGG - Intergenic
1137286215 16:47017816-47017838 GCTTGATCCAGGCCACCTTCTGG - Intergenic
1138512212 16:57515282-57515304 CTTCCAGCCAGGGAACCCTCCGG - Intronic
1138591070 16:58000187-58000209 TCTCCAGCCCGGCCGCCCTCGGG - Intronic
1139595862 16:67957951-67957973 CCACCATCCAGGTCAGCCGCAGG + Exonic
1139599810 16:67979886-67979908 CCTCCCTCCAACCCAACCTCAGG - Intronic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1140482613 16:75269974-75269996 TCTCCATAGAGTCCACCCTCAGG - Intergenic
1141522134 16:84587697-84587719 CGTCCCTCCTGGCCACTCTCTGG - Intronic
1141830984 16:86509979-86510001 CCTCCGTCCCTGCCCCCCTCGGG - Intergenic
1142235532 16:88920821-88920843 CCTCCAGCCAGGCCCACCTGAGG + Intronic
1143135548 17:4710576-4710598 CCTCCCTCCCGGCCCCGCTCTGG - Intronic
1143137900 17:4722110-4722132 CCTCCCTCCAGCCCAGCCTGGGG - Intergenic
1144993349 17:19249293-19249315 TCTCCCTCCCAGCCACCCTCAGG - Intronic
1145126074 17:20301025-20301047 GCCCCATCCTGGCCACACTCTGG + Intronic
1145939306 17:28734201-28734223 CCTCCAGCCAGGCCACTGTAAGG - Intronic
1145939945 17:28738010-28738032 CACCCATCCAGGCCACCCCCTGG - Intronic
1148104262 17:45110996-45111018 CCCAGTTCCAGGCCACCCTCTGG + Exonic
1148465959 17:47865480-47865502 CCTGCCTCCAAGCCACCCTGGGG + Intergenic
1149442987 17:56690796-56690818 CCTCCGTCCTGGCCTCTCTCCGG - Intergenic
1151351213 17:73533273-73533295 CGTGCAGCCAGGCCACACTCTGG + Intronic
1151847149 17:76664587-76664609 ATTCCATCCAGGCTACCTTCAGG - Intergenic
1152078834 17:78174288-78174310 CGTGAATCCAGGCCATCCTCAGG + Exonic
1152091454 17:78249860-78249882 CCTCCCTCTATGCCTCCCTCAGG - Intergenic
1152113167 17:78368552-78368574 CCTCCCTCCAGGCCACTCGGTGG + Intergenic
1152170280 17:78741798-78741820 ACTCCCTCCAGGACAGCCTCCGG + Intronic
1153627043 18:7031274-7031296 CCTGAAGCCAGGCCACACTCTGG - Intronic
1155226667 18:23735217-23735239 CCTGGTTCCAGGCCAGCCTCAGG - Intronic
1155755477 18:29489739-29489761 CCTCCATGCAGACCTCCTTCTGG + Intergenic
1159995431 18:74960214-74960236 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995468 18:74960394-74960416 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995505 18:74960574-74960596 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995537 18:74960718-74960740 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995544 18:74960754-74960776 CCTCCATGCAGTCCTCACTCAGG - Intronic
1159995574 18:74960898-74960920 CCTTCACCCAGTCCACACTCAGG - Intronic
1159995583 18:74960934-74960956 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995591 18:74960970-74960992 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995600 18:74961006-74961028 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995609 18:74961042-74961064 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995618 18:74961078-74961100 CCTCCACCCAGTCCTCGCTCAGG - Intronic
1160426779 18:78783285-78783307 TCTCCAGCCAGCCCACCCTCCGG - Intergenic
1160739398 19:679090-679112 GCTCCCTCCAGACCCCCCTCTGG + Intronic
1160851535 19:1195244-1195266 CCTCCCTCCTGGCCTCTCTCTGG - Intronic
1160851959 19:1197058-1197080 CCTCCCTCCTGGCCTCTCTCTGG - Intronic
1160907076 19:1456498-1456520 CCTCCATCCAGCACCCCCTCGGG + Intronic
1160979606 19:1810980-1811002 CCGCCAGCCATGCCAGCCTCTGG + Intronic
1161265365 19:3361127-3361149 CCTCCAGCCAGGACCCCCTCGGG - Intronic
1162030063 19:7913438-7913460 CCTCCATCCCTGACTCCCTCCGG - Exonic
1162301393 19:9847068-9847090 CCTGACTCCAGGCCACCCCCAGG - Intronic
1162465347 19:10836185-10836207 CCATCATCCGGGTCACCCTCTGG + Exonic
1163405827 19:17121627-17121649 CCTCCTTCCAGCCCTCCCTAAGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164561914 19:29298381-29298403 CCTCCATCCTCCCCACCCTTGGG - Intergenic
1164715398 19:30387201-30387223 CCCACATCCAGGCCTCCCTCTGG - Intronic
1165100272 19:33434946-33434968 CTTCCCTCCAGGCCGTCCTCAGG - Intronic
1165404667 19:35622342-35622364 GCCCCATCCAGGCCTCCTTCTGG - Intronic
1165495572 19:36150556-36150578 CCTCCCTCCAGCCCAGACTCTGG - Intergenic
1167207025 19:48109613-48109635 CCAAATTCCAGGCCACCCTCAGG - Intronic
1167249615 19:48393109-48393131 CCCCCGTACAAGCCACCCTCAGG - Intergenic
1167268065 19:48493303-48493325 CCTCCCTCCAGGCCCCGCCCTGG + Intronic
1167390794 19:49193638-49193660 CCTCCAGCCAGGCCACAGGCAGG - Intronic
1167583260 19:50358845-50358867 CGTCCATCCCCCCCACCCTCGGG + Intronic
1168719849 19:58548928-58548950 CCTCCATCCACCTCACCCCCAGG - Intronic
924991612 2:317420-317442 GGACCATCCAGGCCTCCCTCAGG - Intergenic
925234448 2:2265862-2265884 CCTCCATCCATGCCTCCTTAGGG - Intronic
925477061 2:4229315-4229337 CCGTCAGCCATGCCACCCTCAGG - Intergenic
929900793 2:46001609-46001631 CCTCACTCCAGAGCACCCTCTGG - Intronic
929929304 2:46239685-46239707 CATCCAACCAGGCTGCCCTCAGG - Intergenic
929992564 2:46802298-46802320 CCTCCAAGCAGGGCACCGTCTGG - Intergenic
930416691 2:51098067-51098089 CCACCATCCATGCCACCATGGGG - Intergenic
931257136 2:60583562-60583584 ACTCCTTCCAGCCCAACCTCAGG - Intergenic
931459346 2:62436824-62436846 CCTGCAGGCTGGCCACCCTCAGG + Intergenic
931704896 2:64939158-64939180 CCTCCCTCCAAGCCAACCTCTGG - Intergenic
932344102 2:70984664-70984686 GCTGCACCCAGGCCACTCTCTGG + Exonic
932539654 2:72638941-72638963 CCTCCTTGCAGGGCAACCTCAGG + Intronic
933726236 2:85429302-85429324 ACTTCATCCAGGACACTCTCAGG - Intronic
934718074 2:96554666-96554688 CATGCTTCCAGGGCACCCTCTGG + Intergenic
935824402 2:106930165-106930187 CCTCCATCCAGGCCATGGTATGG + Intergenic
935862698 2:107350205-107350227 TCTCCAGACAGCCCACCCTCAGG - Intergenic
937114217 2:119392691-119392713 CCTCTATCCAAGCCACCCACAGG + Intergenic
937239429 2:120450739-120450761 GCTCCATCCAGCCCACCAACGGG + Intergenic
937989467 2:127654266-127654288 CCTCCCTCCAGGTCACCCCGGGG - Intronic
938096671 2:128468405-128468427 CTCCCAGCCAGGCCTCCCTCAGG - Intergenic
944673396 2:202015192-202015214 TCTCCATCCACGCCTCCATCAGG - Intergenic
945987870 2:216369988-216370010 CCTCCAGCCTGCCCACCCCCCGG + Exonic
946870414 2:224079408-224079430 CCTCCATCCAACCCAAACTCAGG + Intergenic
948173983 2:235928773-235928795 CCACCATCGAAGCCACCCTGTGG - Intronic
948256894 2:236574905-236574927 CCTCCATCCCTGCCAGCCTATGG - Intronic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
1169970966 20:11269121-11269143 ACTCCATCCAGACCTCCTTCAGG + Intergenic
1172331590 20:34079430-34079452 CCTCCACCCAAGCCACCCCAAGG - Intronic
1172883269 20:38215313-38215335 CCTCCACACAGGCCATCCCCAGG + Intronic
1172902109 20:38342929-38342951 CCTCCTGCCATGCCACCCTCTGG + Intergenic
1172997917 20:39084201-39084223 ATCCCATCCAGGGCACCCTCAGG - Intergenic
1173645003 20:44627767-44627789 CCCACATCCAGGCATCCCTCTGG - Intronic
1173927792 20:46793602-46793624 CTACCATCCTGGCCAGCCTCAGG - Intergenic
1175860340 20:62147149-62147171 GCTCCATGCAGGCCAGGCTCGGG - Intronic
1175921552 20:62452749-62452771 TCTCCACCCAGATCACCCTCTGG + Intergenic
1176261038 20:64180501-64180523 CCTCTCTGCAGGCCAACCTCTGG + Intronic
1176675110 21:9770513-9770535 CCTGCTCCCAGGCCACCCCCAGG - Intergenic
1179889143 21:44327010-44327032 CCACCTGCCAGGCCTCCCTCGGG + Exonic
1180921902 22:19525399-19525421 CCAGCCCCCAGGCCACCCTCCGG + Intronic
1181019034 22:20088673-20088695 CCTGTACCCAGGCCACCATCAGG - Intronic
1181288513 22:21772497-21772519 TCTCCACCCCGGCCATCCTCAGG + Intronic
1181684694 22:24520299-24520321 CCTGCAGCCAGGCCAGGCTCAGG + Intronic
1181910612 22:26235473-26235495 CCTCCAGCCAGGCAACTCTGAGG - Intronic
1181930381 22:26396119-26396141 CCTGCATCCAGGGCATCCCCAGG - Intergenic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1182353439 22:29711341-29711363 CCTTCAGCCAGGTCACCCTGTGG - Intergenic
1182452434 22:30429421-30429443 CCACCATCTTGGCCACCTTCAGG - Intergenic
1182475425 22:30574277-30574299 GCCCCTACCAGGCCACCCTCTGG + Intronic
1182558928 22:31143785-31143807 CCTCCAGCCAGAGCACCATCAGG - Intergenic
1182572884 22:31251987-31252009 CATCCAGCCAGGCCTTCCTCAGG + Intronic
1183300814 22:37058250-37058272 CATCCCTCCAGGCCATCCTGGGG - Intronic
1183482844 22:38074578-38074600 GCTCCACCCAGGCCAGGCTCTGG - Intronic
1183589351 22:38770744-38770766 CCTGCCCCCAGCCCACCCTCCGG + Intronic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
1183816691 22:40307772-40307794 CCTCCACCCACCCCACACTCAGG + Intronic
1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG + Intergenic
1184489286 22:44799873-44799895 CCTGCATGCAGGACACCCTGGGG - Intronic
1184713632 22:46268087-46268109 CCCCCAACCAGGTCCCCCTCGGG + Intronic
1185065395 22:48629408-48629430 TCTGCCTCCAGGCCCCCCTCCGG + Intronic
1185086329 22:48742885-48742907 CCTCCATGCAGCCCACACGCGGG + Intronic
950534444 3:13571074-13571096 CCACCATCCAGGCACCCCCCTGG + Exonic
951619604 3:24586855-24586877 CTTCCCTCCAGTGCACCCTCTGG + Intergenic
951705542 3:25540700-25540722 CCTCCATCCACAGCACCCTGGGG - Intronic
953483137 3:43269670-43269692 ACTCCATCCAGCCCACCTTCAGG - Intergenic
955386434 3:58484835-58484857 TCAGCTTCCAGGCCACCCTCTGG - Intergenic
955403379 3:58609602-58609624 CCTTCCTCCATGCCACCCTAGGG - Intronic
956384436 3:68701843-68701865 CTTCCTTCCAGGCCTCTCTCAGG + Intergenic
960691320 3:120349237-120349259 CCTCCATCCTGGCCACCGCACGG + Exonic
961569505 3:127787664-127787686 CCTCCAGCGAGGACACCCTCAGG - Intronic
964282390 3:155080255-155080277 CCCTCCTCCAGGTCACCCTCTGG - Intronic
964413263 3:156421679-156421701 CCACCTTCCAGCCCACCCCCAGG - Intronic
968185158 3:196627979-196628001 CTTCCAACCAGGCCGCCCCCTGG - Intergenic
968473615 4:792709-792731 CCTCCATCCACTCGACCCTCTGG + Intronic
968575635 4:1364786-1364808 CCACCACCCTGGCCACCCTGGGG + Intronic
968595620 4:1480919-1480941 CATCCATCAAGCCCACCCTGTGG - Intergenic
968664004 4:1810856-1810878 CCTGCAGCCAGGCCACGCTGAGG + Intergenic
968691024 4:1990257-1990279 CCACCAGCCTGGCTACCCTCGGG - Intronic
968890014 4:3363848-3363870 CAGCCCTCCAGGCCACCCTCAGG - Intronic
969208305 4:5665482-5665504 CCACCTTCCAAACCACCCTCAGG + Intronic
969259446 4:6024210-6024232 CCACCAACCAGGCCACACTTGGG - Intergenic
969537418 4:7765230-7765252 CCTCCCAACAGGCCACACTCTGG + Intronic
969583050 4:8076754-8076776 CCACCCTGCAGCCCACCCTCTGG - Intronic
969902216 4:10360457-10360479 CCTGTACCCAGCCCACCCTCTGG + Intergenic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
971500877 4:27316690-27316712 CCTTCATCAATCCCACCCTCAGG - Intergenic
972193794 4:36627797-36627819 CCTGCATCCTGGGAACCCTCTGG - Intergenic
972726239 4:41748398-41748420 CCTGCAGCCTGGGCACCCTCAGG - Exonic
972995075 4:44869864-44869886 TCCCCAACCAGGCCTCCCTCTGG + Intergenic
981031173 4:140127263-140127285 CCTCCATCCATGGAGCCCTCAGG + Intronic
982351087 4:154416238-154416260 CCTCCTTCCAGGCTGTCCTCGGG - Intronic
983908489 4:173209657-173209679 CCTCCATCACTGCCTCCCTCAGG + Intronic
984807799 4:183767311-183767333 CCTCCATGCAGGGCACCTTTTGG - Intergenic
985778053 5:1855478-1855500 CCTCAACTCAGGCCACCCTCAGG - Intergenic
985821892 5:2166208-2166230 CCTCCATGCTGGCACCCCTCAGG - Intergenic
985908911 5:2863942-2863964 ACATCATCCAGGCCTCCCTCTGG + Intergenic
986298865 5:6462458-6462480 GCTTCAGCCATGCCACCCTCGGG - Intronic
990205776 5:53427585-53427607 CCTCCAACCACCCCACCCTTAGG + Intergenic
991163286 5:63531100-63531122 CCTCCCACCAGGCCCCACTCTGG - Intergenic
993306684 5:86283361-86283383 GCTCCATCCAGGGGACCCTGGGG + Intergenic
994043567 5:95284501-95284523 CCTCCTTCCAGGCCCGGCTCTGG - Exonic
997564337 5:134875346-134875368 CCTCCATCCAGGACACCCCAGGG - Intronic
998094669 5:139390506-139390528 CCTCCACCCAGGCCATACCCAGG + Intergenic
998135830 5:139674055-139674077 TCTCACCCCAGGCCACCCTCTGG + Intronic
998747527 5:145277866-145277888 CTTCCCTCTAGGCCACCCTGTGG + Intergenic
999103608 5:149049252-149049274 CATCCATCCAGGCCTCCATCTGG + Intronic
999159944 5:149487122-149487144 CCTCCATCCTGGCCATCCCCAGG - Intergenic
1001313978 5:170629893-170629915 ACTCCATCCAGCCCATCCTAAGG + Intronic
1001549556 5:172593333-172593355 CCTCCCTCCAGTCCATCCTCGGG - Intergenic
1003195015 6:3906629-3906651 CCTGCATCCTGGCCTACCTCTGG - Intergenic
1003278854 6:4674980-4675002 CCTCCCTCCAGTCCACCCAGAGG + Intergenic
1003395533 6:5749420-5749442 CTTCCATCCAGGCCACCAGCAGG - Intronic
1004323475 6:14652043-14652065 CCACCATCCAGGCCTGCCCCAGG + Intergenic
1006920852 6:37626182-37626204 CCTCCCTGCAGGCCCTCCTCAGG + Intergenic
1007408763 6:41649608-41649630 CATCTCTCCAGGCCAGCCTCAGG + Exonic
1007417160 6:41698417-41698439 CCATCATCCCGGACACCCTCTGG - Intronic
1007634610 6:43291177-43291199 CCTCCAAGAAGGCCACTCTCTGG + Intergenic
1007745971 6:44043104-44043126 CCTCCCTTCAGGCCTCCCTGGGG + Intergenic
1010514699 6:76759406-76759428 CCTCCACCCAGGCCCCACTGTGG + Intergenic
1015262939 6:131259342-131259364 TCACCATCCTGGCCTCCCTCAGG - Intronic
1016637064 6:146304794-146304816 CCGCCTTCCAGGACACCTTCTGG + Exonic
1017607442 6:156148929-156148951 CCTCCCTTCATTCCACCCTCCGG - Intergenic
1019147066 6:169982325-169982347 CCTCCATCCCGGGCACACACAGG + Intergenic
1019395117 7:813903-813925 CCTCCACCCTGCCCACCCTGGGG - Intergenic
1019539175 7:1544132-1544154 CCTCCCTGCAGCCCACCCTGCGG + Exonic
1019685552 7:2380013-2380035 ACAGCAACCAGGCCACCCTCAGG - Intronic
1023955586 7:44884696-44884718 TCTCCATACAGGCCGCCCCCTGG + Exonic
1024599965 7:50971571-50971593 GCCCCAGCCAGGGCACCCTCTGG - Intergenic
1025483439 7:61015894-61015916 CCTCCATCCACGGTGCCCTCAGG - Intergenic
1028399020 7:90404373-90404395 CCTCAATCCAGGAAACTCTCAGG + Intronic
1031088332 7:117324339-117324361 CCTCTCTCCAGCCCACCCTCGGG + Intergenic
1032068848 7:128791676-128791698 CCTCCATCCTGGCCTCCACCGGG + Intronic
1032458222 7:132089558-132089580 CCTCAAGCCAGACCAGCCTCAGG - Intergenic
1033290246 7:140077253-140077275 CATCCATCGAGGTCAGCCTCTGG - Intergenic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1034273277 7:149813416-149813438 CCTCCCTCCCCTCCACCCTCAGG + Intergenic
1034447151 7:151119624-151119646 CCTCCTTCCAGACCACCTGCAGG + Intronic
1034720708 7:153290037-153290059 TCTCCCTCCAGGCCTCCCACTGG - Intergenic
1034994740 7:155570711-155570733 CCTCCTTCCAGGCCCCTCACAGG + Intergenic
1035024289 7:155815993-155816015 CCTGCAGCCAGGCCACAATCAGG - Intergenic
1035283841 7:157794001-157794023 CCACCCTCCAGGCCACCTTCGGG + Intronic
1035563516 8:626673-626695 CCTCTAGGCAGGCCACCCTCTGG - Intronic
1035627529 8:1082620-1082642 CCTCCATCCAGGGCTCCTCCTGG + Intergenic
1037754139 8:21700530-21700552 CCTGCCTCCTGGCCACCTTCTGG - Intronic
1038509287 8:28115855-28115877 CCTCCTTCCCTACCACCCTCAGG + Intronic
1040292836 8:46134207-46134229 CTTCCATCCCAGCCACCCCCAGG - Intergenic
1040307662 8:46220584-46220606 CGTCCATTCAGGCCACCCTGTGG - Intergenic
1040578390 8:48674484-48674506 CCGCCAGCCAGGCCTCCCTCAGG + Intergenic
1041576182 8:59398226-59398248 CCCCCATCCCTTCCACCCTCTGG - Intergenic
1042868527 8:73377149-73377171 CCACCATTTATGCCACCCTCGGG + Intergenic
1044233545 8:89805793-89805815 AATCCATCCAAGTCACCCTCTGG + Intergenic
1046622975 8:116547347-116547369 CCTCCATCCAGTCCCCACTGAGG + Intergenic
1047905465 8:129468270-129468292 CCTCCATCCAAGGTACCCTGTGG + Intergenic
1048451256 8:134535576-134535598 CCTACACCAAGGCCACACTCTGG + Intronic
1048687464 8:136919842-136919864 TCTCCATCCTGCTCACCCTCTGG - Intergenic
1049258885 8:141628228-141628250 CACCCCTCCAGGCCACACTCAGG - Intergenic
1049471048 8:142775179-142775201 CCATCCTCCTGGCCACCCTCTGG - Intronic
1049491178 8:142903878-142903900 CCTCCATCGAGGTCACACTTTGG - Intronic
1051194307 9:14546825-14546847 CCCACATCCAGGCCACACTGGGG + Intergenic
1051599948 9:18862755-18862777 CCTGCAGCCAGGCCTCCCTAGGG + Intronic
1053139535 9:35674070-35674092 CCTGCATCCGGGGCAACCTCTGG - Exonic
1053510024 9:38679803-38679825 GCTCCATGCAGGCAACACTCAGG - Intergenic
1055204235 9:73708356-73708378 CATCCATTCAGGTCAGCCTCAGG - Intergenic
1055990623 9:82102041-82102063 CCACCATCCTGCCCACCCTGTGG - Intergenic
1057194775 9:93110862-93110884 CCTCCCCAGAGGCCACCCTCTGG + Intronic
1058758097 9:108102430-108102452 ACTCCCTCCAAGCCAACCTCAGG - Intergenic
1059799905 9:117739661-117739683 CTTCCTTCCAGGCCCACCTCTGG - Intergenic
1059991271 9:119868708-119868730 CCCACATCCAACCCACCCTCAGG + Intergenic
1060103929 9:120862053-120862075 CCTCCCTCTGGGCCACCCTAGGG - Intronic
1060298685 9:122360986-122361008 CCCTCCTCCAGGCCACCCTTAGG - Intergenic
1060876066 9:127084436-127084458 CCACCATCCAGGCAGCCCTCTGG + Intronic
1061236026 9:129343029-129343051 CCTCCTCCCAGCCCAGCCTCTGG - Intergenic
1061478326 9:130884028-130884050 TCTTCATTCAGGCCGCCCTCCGG - Exonic
1061893266 9:133633839-133633861 CCTCCATCCTGGCCAGCCTTGGG - Intergenic
1185587836 X:1253650-1253672 CATCCCTCCAGGCCACGTTCTGG + Intergenic
1186841134 X:13485705-13485727 TCTCCACCATGGCCACCCTCAGG + Intergenic
1188005932 X:25015788-25015810 CACCCATCCATCCCACCCTCCGG - Exonic
1189439141 X:41018830-41018852 TCTCCAGGCAGGCCAGCCTCTGG - Intergenic
1190884301 X:54517877-54517899 CCTCCAGCCAAGCCACCAACTGG - Intergenic
1192501006 X:71652199-71652221 CCTTCACTCAAGCCACCCTCAGG + Intergenic
1195560473 X:106276976-106276998 CCTCCATGCAATCCACACTCTGG + Intergenic
1195561489 X:106289363-106289385 CCTCCATGCAATCCACACTCTGG - Intergenic
1195923488 X:110003694-110003716 CCACCACCCGGGCAACCCTCTGG + Exonic
1197137052 X:123073545-123073567 GCTCCAGCCAGGCCAACCACTGG - Intergenic
1198313050 X:135438596-135438618 CCTCCAGCTAGTGCACCCTCTGG - Intergenic
1199943670 X:152648847-152648869 CCTCCATCCAGGCCTGCCTCTGG - Intronic
1200072467 X:153535933-153535955 CCACCAGCCAGGCCACTCCCGGG - Intronic
1200074528 X:153544543-153544565 TCTCCCTCCAGGGCCCCCTCAGG - Intronic
1200255544 X:154580574-154580596 CTTACATCCAGGCCACACTGAGG - Intergenic
1200262225 X:154623830-154623852 CTTACATCCAGGCCACACTGAGG + Intergenic