ID: 948389692

View in Genome Browser
Species Human (GRCh38)
Location 2:237603021-237603043
Sequence CAATTCTAACACTGTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 904
Summary {0: 1, 1: 2, 2: 62, 3: 261, 4: 578}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948389692_948389694 -9 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389694 2:237603035-237603057 TTAGAATTGAACACCCAGCTGGG 0: 1
1: 1
2: 3
3: 5
4: 124
948389692_948389698 11 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389698 2:237603055-237603077 GGGGCCCACTGCTTAATGTGTGG 0: 1
1: 0
2: 3
3: 12
4: 104
948389692_948389700 13 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389700 2:237603057-237603079 GGCCCACTGCTTAATGTGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 120
948389692_948389695 -8 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389695 2:237603036-237603058 TAGAATTGAACACCCAGCTGGGG 0: 1
1: 0
2: 1
3: 10
4: 120
948389692_948389699 12 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389699 2:237603056-237603078 GGGCCCACTGCTTAATGTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 104
948389692_948389693 -10 Left 948389692 2:237603021-237603043 CCAGGTGGACAGTGTTAGAATTG 0: 1
1: 2
2: 62
3: 261
4: 578
Right 948389693 2:237603034-237603056 GTTAGAATTGAACACCCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948389692 Original CRISPR CAATTCTAACACTGTCCACC TGG (reversed) Intergenic
900708678 1:4097040-4097062 CAGTTCTGACACTGTCTACCCGG + Intergenic
900845480 1:5096870-5096892 CAATTCTGACACTATCTCCCTGG - Intergenic
901385210 1:8903696-8903718 CAATTTCAACACTATCTACCTGG - Intergenic
901488061 1:9579253-9579275 CACTTCCGACACTGTCTACCAGG + Intronic
901886160 1:12224730-12224752 CAATTCTGACACTACCTACCTGG + Intergenic
902313070 1:15596833-15596855 CAATCCTGACACTATCTACCTGG - Intergenic
902992630 1:20199839-20199861 GAATTCTAAGACTGTCCAATGGG + Intergenic
904056777 1:27676003-27676025 CAATTCTGACACTGTCTACCTGG + Intergenic
904186813 1:28711895-28711917 CAATTCTGATACTATCCCCCTGG + Intronic
904218264 1:28942240-28942262 CAATTCTGACACTATCTACCTGG + Intronic
904551397 1:31322216-31322238 CAATTCTGACACTAACTACCTGG + Intronic
905233954 1:36532740-36532762 CAATTCTGACACCATCTACCTGG - Intergenic
905235849 1:36547627-36547649 CAATTCTGACACTGTCTACTTGG + Intergenic
905250747 1:36646731-36646753 CAATTCTGACAGTATCTACCAGG + Intergenic
905283863 1:36866733-36866755 CAATTCTAACTCAGGCCAACTGG + Intronic
905582542 1:39093221-39093243 CAATTACAACACTGTCTACCTGG + Intronic
905692073 1:39950853-39950875 CAATTCCAACACTACCTACCTGG + Intergenic
905764230 1:40586882-40586904 GAATTCTAATACTATCTACCTGG + Intergenic
905829072 1:41049739-41049761 CAATTCTCACTCTGTCCCCCAGG - Intronic
905935057 1:41816852-41816874 CTCTGCTAGCACTGTCCACCTGG + Intronic
906183739 1:43843839-43843861 CAATTCTGGCATTATCCACCTGG + Intronic
907232344 1:53011702-53011724 CAATTCTAACACTATTTACCTGG - Intronic
908226160 1:62057845-62057867 CAATTCTAACACAGTTCTCTTGG - Intronic
908293901 1:62694029-62694051 CAGTTCTGACACTGTCTACCTGG + Intergenic
908311507 1:62889156-62889178 CTATTATAACACTGTGCACATGG + Intergenic
908447515 1:64214900-64214922 CAATTCTAAGACTTTTCAACAGG + Exonic
908505235 1:64790855-64790877 CAATTCTAGCACTAACTACCTGG + Intronic
908560477 1:65301379-65301401 CAATTCTGAAACTATCTACCAGG + Intronic
908727611 1:67193813-67193835 CAATTCTGACTCTGTCTACCTGG + Intronic
909281181 1:73755766-73755788 CAATTCTGATACTGTCTACCTGG + Intergenic
909523253 1:76593617-76593639 CAATTCTAACACTCTTGATCGGG - Intronic
910102909 1:83597919-83597941 CAATTCTGACACTGTCTTCCTGG + Intergenic
910582943 1:88848266-88848288 CAATTCTGCCACTGTTTACCTGG - Intergenic
911120011 1:94286926-94286948 CAATTCCAACACTATCAACCTGG + Intergenic
911841456 1:102687185-102687207 CAATTCTAACACTAACCTCCTGG - Intergenic
911952019 1:104185199-104185221 CAATTCTGACACTCTCTACCTGG - Intergenic
912113315 1:106371578-106371600 AAATGCTGACACTGTCCACAGGG - Intergenic
912819571 1:112856009-112856031 CAACTGTCACACTATCCACCTGG - Intergenic
913187789 1:116385725-116385747 CAATTCCAACACTATCTACCTGG - Intronic
914406450 1:147378889-147378911 AAATTCCAACACTCTCTACCTGG + Intergenic
914698867 1:150112634-150112656 CAATTCTGACACGATCTACCTGG + Intronic
915183469 1:154083571-154083593 CAATTCTGACACTATCTACCTGG - Intronic
915727316 1:158027006-158027028 CAACTCTGACACTATCTACCTGG + Intronic
915947346 1:160163296-160163318 CAACTCTGACACAATCCACCTGG + Intronic
915962178 1:160275957-160275979 TAATTCTGACACTGTCTACCTGG - Intergenic
916462773 1:165044508-165044530 CAATTCTGACACTATCTACCTGG + Intergenic
916480474 1:165209937-165209959 TAATTCTGACACTCTCTACCTGG - Intronic
916531401 1:165660138-165660160 CAATTCTGACACTATCTACCTGG + Intronic
916550490 1:165845158-165845180 CAATTCTGACACGATCTACCTGG - Intronic
917228704 1:172813002-172813024 CAATTCTGACTCTGTCTACTTGG - Intergenic
918019871 1:180677075-180677097 CAATTCTGACACTGACTACCTGG + Intronic
918075499 1:181168114-181168136 CAATTCGGACACTGTCTACCTGG - Intergenic
918141433 1:181723541-181723563 CAATTCTGACGCTATCTACCTGG + Intronic
918566781 1:185943360-185943382 CAGTTCTGACACTATCTACCTGG - Intronic
919493120 1:198229552-198229574 CAATTCCAACACTATCTTCCTGG - Intronic
919678781 1:200412159-200412181 CAATTCTGACACTACCTACCTGG - Intergenic
920062451 1:203236878-203236900 CCATTCTGACACTATCCATCTGG - Intronic
920720193 1:208380001-208380023 CAGTTCTAACACTGTCTACCTGG - Intergenic
920793050 1:209110914-209110936 CAATTGTGACACTATCTACCTGG - Intergenic
920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG + Intronic
921244343 1:213220801-213220823 CAATTCTAACACTGAATAACTGG - Intronic
921436884 1:215134231-215134253 CAATTCTGACACTGTCTACCTGG + Intronic
921467645 1:215509315-215509337 CAATTCTGACACTGTCTACCTGG + Intergenic
921584896 1:216935199-216935221 CAATTCTGACACTCCCTACCTGG + Intronic
921674461 1:217962758-217962780 TAATTCTGATACTGTCTACCTGG - Intergenic
921768099 1:218997315-218997337 CAATTCTAACACCAACTACCTGG - Intergenic
922006328 1:221534357-221534379 CAATTCTGACACTACCTACCTGG + Intergenic
922204765 1:223436733-223436755 CAATTCTGACTCTAACCACCTGG + Intergenic
922333425 1:224597929-224597951 CAATTCTGACACTGTGTACCTGG - Intronic
922601423 1:226857664-226857686 CAATTCTGACACTACCTACCTGG - Intergenic
922754373 1:228086883-228086905 CAATTCTGACACTGTCTACCTGG - Intronic
922761393 1:228134098-228134120 CAATTCTAACACTATCTACCTGG + Intergenic
922805249 1:228383325-228383347 CAATTCCAACACTGTCTACCTGG + Intergenic
922848868 1:228713843-228713865 CAGTTCTAACAGCATCCACCTGG - Intergenic
922966820 1:229697514-229697536 CAATTCCCACACTGTCTACCTGG + Intergenic
923074539 1:230598073-230598095 GAATTCTGACACTGTCTACCTGG + Intergenic
923916360 1:238510460-238510482 CAACTCCAACACTGTCTACCTGG - Intergenic
924063220 1:240197544-240197566 CAATTCTAACACTATCTACCTGG - Intronic
924143993 1:241055200-241055222 CAATTCGGACACTATCTACCCGG + Intronic
924236009 1:242000132-242000154 CAACTCTGACACTGTCTACCTGG + Intergenic
924417240 1:243869705-243869727 CAATTCTGACTCTATCTACCTGG - Intergenic
924469694 1:244331029-244331051 CAATTCTGACAGTATCTACCTGG - Intergenic
924697548 1:246416526-246416548 CAATTAGAACAGTGTCCACTGGG + Intronic
1063869904 10:10405740-10405762 CAATTCTGACACCCTCTACCTGG - Intergenic
1064268206 10:13841958-13841980 CAATTCTGGCACTAACCACCTGG - Intronic
1064417614 10:15164155-15164177 CAATTCTCGCTCTGTCCCCCAGG - Intronic
1064979297 10:21149822-21149844 CAATTCCAACCCTATCTACCTGG - Intronic
1065000793 10:21336096-21336118 AAAGTCTCACTCTGTCCACCAGG + Intergenic
1065053610 10:21820594-21820616 CAATTCTGACCCTATCTACCTGG + Intronic
1065066058 10:21966232-21966254 TAATACTAACACTGTTCACTTGG + Intronic
1065213826 10:23430794-23430816 TAATTCTGACACTATCTACCTGG + Intergenic
1065300829 10:24319641-24319663 AAATTCTCACACTATCCACCAGG - Intronic
1065355928 10:24841811-24841833 CAGTTCTAACACTAACTACCTGG + Intergenic
1065468047 10:26046254-26046276 CAATTCTGTCACTATCTACCTGG - Intronic
1065768347 10:29053270-29053292 CAATTCTGATACTGTCTACCTGG + Intergenic
1065935779 10:30519447-30519469 CAATTCCACCACTATCTACCTGG + Intergenic
1066504151 10:36024528-36024550 CAATTCTGACACCGTCCAACTGG + Intergenic
1067134107 10:43593204-43593226 TAATTCTAAGACTGTAAACCAGG + Intergenic
1067859622 10:49831989-49832011 CAAATCTGACACTGACTACCTGG - Intronic
1068475319 10:57516597-57516619 CAGTTCTGAGACTATCCACCTGG - Intergenic
1068758688 10:60683039-60683061 CAGTTCTGACACTGTCTACCTGG - Intronic
1069176801 10:65300256-65300278 CAATTCTGACACTGTCTACCTGG - Intergenic
1069375546 10:67789074-67789096 TAATTGTGACACTGTCTACCTGG + Intergenic
1069763273 10:70831323-70831345 CAATTCTGACACTGTCTACCTGG + Intronic
1070083426 10:73210991-73211013 CAGTTCTGACACAGTCTACCAGG + Intronic
1070304018 10:75227394-75227416 CAATTCTGATACTATCTACCTGG - Intronic
1070522280 10:77264538-77264560 CAATTCTTTCACTGTGTACCTGG - Intronic
1070764838 10:79050399-79050421 CACTTCAAACACCATCCACCTGG + Intergenic
1071849792 10:89557172-89557194 CAGTTCTGACAGTATCCACCTGG - Intergenic
1071859594 10:89658678-89658700 CAGTTCTTACACTGGCTACCTGG + Intergenic
1072311090 10:94156235-94156257 CAATTCTGACATTTTCCACCTGG + Intronic
1072350937 10:94556153-94556175 CAATTCTGACACTATCTACGGGG - Intronic
1072594823 10:96861852-96861874 CAATTCCAACACTATCTACCTGG + Intronic
1073232518 10:101984011-101984033 CAATTCTGACACTATCTACCTGG - Intronic
1076041496 10:127253432-127253454 CAATTCTGACACCATCTACCTGG + Intronic
1076111826 10:127865550-127865572 CACTTCTGACACTATCTACCTGG - Intergenic
1077086248 11:752939-752961 CAATTCCAACCCTGTCTACCTGG - Intronic
1078212993 11:9286391-9286413 CATATCTAACAGTGTCCAGCTGG - Intronic
1078257564 11:9673075-9673097 CAATTCCAACACTATCTACCTGG + Intronic
1078346549 11:10554687-10554709 AAATTCTGACACTATCTACCTGG - Intergenic
1078379055 11:10823126-10823148 CAATTCCAACACTATCTACCTGG - Intronic
1078872166 11:15357714-15357736 CAGTTCTGACACTGTCTACCCGG - Intergenic
1079769166 11:24437285-24437307 CAATGCTGACACTATCTACCTGG + Intergenic
1080301280 11:30788038-30788060 CAATTCTTACACTATCTACCTGG + Intergenic
1080335942 11:31196331-31196353 CAATTCTGACACTAACTACCTGG + Intronic
1080350707 11:31382773-31382795 CAGTTCTGACACTGTTTACCTGG + Intronic
1080674402 11:34411445-34411467 CAATTCTGACACTATCTACTTGG - Intergenic
1080823565 11:35829290-35829312 CAATTATGACACTATCTACCTGG + Intergenic
1080999958 11:37656410-37656432 CAGTTCAGACACTGTCTACCTGG - Intergenic
1081329351 11:41785203-41785225 CAATTCTGACACTATCCACCTGG - Intergenic
1081471022 11:43371246-43371268 CAGTTCTGACATTGTCTACCTGG + Intronic
1081472863 11:43393158-43393180 CAATTCTGACACTAACTACCTGG + Intronic
1081499505 11:43652457-43652479 CAATTCCGACACTATCTACCTGG + Intronic
1081927223 11:46840965-46840987 CAATTCTGACACTTTCTATCTGG - Intronic
1082160709 11:48885269-48885291 AAATTCTAACACTCTCCCCAGGG + Intergenic
1082161657 11:48895137-48895159 AAATTCTAACACTCTCCCCAGGG - Intergenic
1082704520 11:56477256-56477278 CAGTTCTGACACTATCTACCTGG - Intergenic
1083452793 11:62757344-62757366 TAATGCCAACACTGTCTACCTGG + Intergenic
1083699734 11:64468038-64468060 CAATTCTGACACTATCTACCTGG - Intergenic
1083703225 11:64495075-64495097 CAATTCTGACGCTGTCTACCTGG + Intergenic
1083918342 11:65765017-65765039 CAATTCTGACACCATCTACCTGG - Intergenic
1084156497 11:67316016-67316038 CAATTCCAACTCTGTCTACCGGG - Intergenic
1084338119 11:68473661-68473683 CAATTCCAACACCATCTACCTGG - Intronic
1084993737 11:72955069-72955091 CAATTCTGACACTCTCTTCCTGG + Intronic
1085487575 11:76880440-76880462 CAATTCTGACACTGTCTACTTGG + Intronic
1085693749 11:78686607-78686629 CAATTCCAACACTATCTACCTGG - Intronic
1085741504 11:79081622-79081644 CTATTGTAACTCTGTTCACCAGG + Intronic
1086363833 11:86088123-86088145 CAATTCTGACACTAACTACCTGG - Intergenic
1086470331 11:87102113-87102135 TAATTCTAATACTGTCTACCTGG + Intronic
1087036860 11:93764880-93764902 CAATTCTAACACTATTTACTTGG + Intronic
1088038998 11:105353677-105353699 CAATTCTGACACTAGCTACCTGG + Intergenic
1088205121 11:107383308-107383330 CAGTTCCAACACTGTCTACCTGG - Intronic
1088367573 11:109055298-109055320 CATTTCTGACACTGACCATCTGG - Intergenic
1088434952 11:109802154-109802176 CAATTCTGACATTAGCCACCTGG + Intergenic
1088784005 11:113164374-113164396 CATTTCTGACACTGTCTACCTGG + Intronic
1089235512 11:117021015-117021037 CAGTTCTGACACTGTCTACCTGG - Intronic
1089736277 11:120552224-120552246 CAACTCCAACACTGTCTACCTGG - Intronic
1089970531 11:122689629-122689651 CAGTTCCAACACTGTCTACCTGG + Intronic
1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG + Intergenic
1090289448 11:125529067-125529089 CAATTCTGACGCTGTTTACCTGG - Intergenic
1090417521 11:126550861-126550883 CAATTCTGACACTGTCTACCTGG + Intronic
1090493818 11:127190618-127190640 CAACTCTGACACTGTCTATCTGG + Intergenic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1090556097 11:127878229-127878251 CAATTCTCACATTATCTACCTGG + Intergenic
1091137569 11:133205558-133205580 CAATTCTGACACTGTCTACCTGG - Intronic
1092346341 12:7718189-7718211 CAATTCCAGCACTGTCTACCTGG + Intergenic
1092372140 12:7925413-7925435 TAATTATGACACTGTCTACCTGG - Intronic
1092483251 12:8879463-8879485 CAAGTCTCACTCTGTCCCCCAGG - Intronic
1092590238 12:9946605-9946627 CAATTCTGACAGTATCCACCTGG + Intergenic
1093164825 12:15792057-15792079 CAATTCTGAAACTATCTACCTGG - Intronic
1093425544 12:19024344-19024366 CAATTCTGACACTATCTACCTGG - Intergenic
1093553896 12:20447896-20447918 CAATCCTAACACTATCCACCTGG - Intronic
1093762423 12:22925261-22925283 CAATTCTGACACCATCTACCTGG + Intergenic
1094443704 12:30507294-30507316 CAATTCCAACACTATCTACCTGG + Intergenic
1094481104 12:30882070-30882092 CAATTCCAACACTATCTACCTGG - Intergenic
1094577416 12:31699838-31699860 CAATTCTGACACTATCTACCTGG - Intronic
1094596248 12:31869453-31869475 CAGTTCTGACACTATCCACCTGG + Intergenic
1094686496 12:32721670-32721692 CAATGCTAACACTGTTTACCTGG + Intronic
1095482709 12:42652302-42652324 CAATTCTGACAATATCTACCTGG - Intergenic
1095519137 12:43041261-43041283 CAATTCCGACACTAACCACCTGG + Intergenic
1095673780 12:44892287-44892309 CAATTCTGTTACTGTCCAACTGG + Intronic
1095730985 12:45506461-45506483 CAATTCCAACACTATCTACCTGG - Intergenic
1095786814 12:46119011-46119033 CAACTCTGACACTGTCTACTTGG - Intergenic
1095861558 12:46923626-46923648 CAACTCTAATACTGTCTACCAGG + Intergenic
1096260526 12:50087386-50087408 CATTTCTAACACTTTCAATCCGG + Exonic
1097138013 12:56875566-56875588 CAATTCTAATACTACCTACCTGG - Intergenic
1097729834 12:63116147-63116169 CGATTCCAACACTATCTACCTGG + Intergenic
1098154701 12:67585596-67585618 CAATTCTTAGACTTTCCACAGGG - Intergenic
1098296687 12:69011232-69011254 CGGCTCTAACACTGTCTACCTGG + Intergenic
1098416180 12:70237668-70237690 CAGTTCTGACACTATCTACCTGG - Intergenic
1098493294 12:71106890-71106912 CAATTTTGACACTATCTACCTGG - Intronic
1098825223 12:75287946-75287968 CAATTCTGACATTATCTACCTGG - Intronic
1098901237 12:76113998-76114020 CATTTCTAAGGCTGTCCACAGGG - Intergenic
1099371057 12:81830104-81830126 CCATTCTGACACTATCTACCTGG - Intergenic
1099724358 12:86406897-86406919 CAATTCTAATGCTATCTACCTGG + Intronic
1100232174 12:92619599-92619621 CAATTCTGACACTATCTACCTGG + Intergenic
1100380207 12:94054754-94054776 CAGTTCTGACACTAACCACCTGG - Intergenic
1100411836 12:94326488-94326510 CAATTCTGAAACTATCTACCTGG - Intronic
1100537345 12:95523385-95523407 TAGTTCTGACACTGTCTACCTGG - Intronic
1101582113 12:106050757-106050779 CAATTCCAACACTATCTACCTGG + Intergenic
1101772796 12:107767141-107767163 TAATTCCAACACTATCTACCTGG + Intergenic
1102279634 12:111608719-111608741 CAATTCTGGCACTATCTACCTGG - Intergenic
1102840643 12:116116718-116116740 CAATTCTGACACTGTCTACCTGG - Intronic
1103176669 12:118869920-118869942 CAATTCTGACACTATCTACCTGG - Intergenic
1103986325 12:124769835-124769857 CAATTCTGCCGCTGTCTACCTGG - Intergenic
1104268935 12:127264664-127264686 AAATTCCAACACTATCTACCTGG + Intergenic
1105513196 13:21068148-21068170 CAATTCTGACACTATCTACCTGG - Intergenic
1105531239 13:21222354-21222376 CAGTTCTGACACTGTCTACCTGG - Intergenic
1105864360 13:24445899-24445921 CAATTCTGACACTGGCCGCCTGG - Intronic
1106114864 13:26808727-26808749 CAATTCTAACACTATCTACTAGG + Intergenic
1106217602 13:27717113-27717135 CAATTCTGACTCTGCCTACCTGG - Intergenic
1106371360 13:29136938-29136960 CCATTCTGATACTGTCTACCTGG - Intronic
1106427950 13:29651019-29651041 CAATACTGACACTATCTACCTGG - Intergenic
1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG + Intronic
1107516999 13:41138872-41138894 CAATTCTGACACTGTCTACCTGG - Intergenic
1107868711 13:44728127-44728149 GAATTCCAACACTATCGACCTGG + Intergenic
1108866988 13:54936464-54936486 CAATTCCAACACTGTATACCCGG + Intergenic
1110689246 13:78412733-78412755 CAATTCTGACACTATCTACCTGG + Intergenic
1111509379 13:89241560-89241582 CAATTCCAACACTGTCTACCTGG + Intergenic
1111706864 13:91761419-91761441 CAATTCCAACACTATCTACCTGG + Intronic
1111894980 13:94130247-94130269 CAAAACTAACCCTGTCCACCAGG + Intronic
1112059059 13:95718903-95718925 CAGTTCTGACACTGTCTATCTGG + Intronic
1112367024 13:98764012-98764034 TAAGTCTAAGACTGTCAACCAGG - Intergenic
1112423593 13:99276219-99276241 CAGTTCTGACACTTTCTACCTGG + Intronic
1112592424 13:100776033-100776055 CAATTCCAACACTGTTTACCTGG + Intergenic
1113577655 13:111405376-111405398 CAATCCTGACACTGGCTACCTGG - Intergenic
1114397388 14:22378136-22378158 CAGTGCTGACACTGTCCTCCTGG + Intergenic
1115820739 14:37210210-37210232 CAATTCTGACACTGTGTACTTGG + Intronic
1115826949 14:37289321-37289343 AAATTCTGACACTATCTACCTGG + Intronic
1116151935 14:41153218-41153240 CAATTCTGACACCGTCTACCTGG - Intergenic
1116601773 14:46935010-46935032 AAATTCTGACACTATCCACCTGG - Intronic
1117190845 14:53289560-53289582 CAATTCTGACACTATCTAGCTGG - Intergenic
1117470451 14:56039351-56039373 CAATTCCAACACTATCCTCCTGG + Intergenic
1117969850 14:61240962-61240984 CAATTCTGACACTATGTACCTGG + Intronic
1118020975 14:61713866-61713888 CAATTCTAACACTATCTACCTGG - Intronic
1118242339 14:64072378-64072400 CATTTCTCACACTATCCACCCGG + Intronic
1118535284 14:66757413-66757435 CAATTCTCACTCTGTCACCCAGG + Intronic
1118576704 14:67248986-67249008 CAAGTCTCACTCTGTCCCCCAGG + Intronic
1118597253 14:67445372-67445394 CCATTCTGACACTATCTACCTGG - Intergenic
1118830393 14:69426158-69426180 TAATTCTGACGCTGTCTACCTGG + Intronic
1118955017 14:70473122-70473144 CAATTCTGACACCATCTACCTGG + Intergenic
1119007185 14:70942570-70942592 CAATTCTGACACTGTCTACCTGG + Intronic
1119127070 14:72137397-72137419 CGGTTCTAACACTGTCTACCTGG + Intronic
1119308496 14:73627331-73627353 CAACTCTGACACAGTCTACCTGG + Intergenic
1119885847 14:78141325-78141347 CAATGCTAACACTTACCAGCTGG + Intergenic
1119922554 14:78459858-78459880 AGATTCTGACACTGTCTACCTGG + Intronic
1120073942 14:80134590-80134612 CAATTCTGACCCTATCTACCTGG - Intergenic
1120171971 14:81255150-81255172 CAATTCTGACACTATCTACCTGG - Intergenic
1120180573 14:81338694-81338716 CAATTCTGACACTATCTACCTGG - Intronic
1120371021 14:83636047-83636069 TACTTTTAATACTGTCCACCAGG + Intergenic
1120957484 14:90095765-90095787 CAATTCTGACACTATCTATCTGG + Intronic
1121420941 14:93813570-93813592 TAATTCCAACACTATCTACCTGG - Intergenic
1121459635 14:94064923-94064945 CAATTCAGACACTATCTACCTGG - Intronic
1121519084 14:94573552-94573574 CAATTCCAACACTATCTACCTGG + Intronic
1122215824 14:100203545-100203567 CAATTCTGACACTATCTACCTGG + Intergenic
1122216281 14:100206734-100206756 CAATTCTGACACCATCTACCTGG - Intergenic
1122700268 14:103583664-103583686 CAATTCTGACACTGTCTACTTGG + Intronic
1123797128 15:23783357-23783379 CAAATCTAAGACTGGCTACCAGG - Intergenic
1123854588 15:24395183-24395205 CAATTATAACGCTGCCCACCAGG + Intergenic
1124147402 15:27140290-27140312 CAATTATGACACTGTCCACCTGG - Intronic
1124183724 15:27502544-27502566 CAATTCTAACACTCTCCACCTGG + Intronic
1124207034 15:27730008-27730030 CAATTCCAACACTAACTACCTGG + Intergenic
1124383769 15:29189261-29189283 CAATTCTGACACTCTTTACCTGG - Intronic
1124391511 15:29262865-29262887 CAGTTCCAACACTATCTACCTGG - Intronic
1124434289 15:29634594-29634616 CAGTTCCAATACTGTCTACCTGG + Intergenic
1124649388 15:31463686-31463708 CAACTCCCACACTGTCTACCTGG - Intergenic
1125014645 15:34920415-34920437 CAGTTCAAACACACTCCACCAGG - Exonic
1125074578 15:35598768-35598790 CAATTCTCACAGTCTCTACCTGG + Intergenic
1125125139 15:36211235-36211257 CAATTCCAACACTATCTACCTGG + Intergenic
1125378554 15:39060692-39060714 TCATTCTAACGCTGTCCACCTGG - Intergenic
1125637409 15:41200751-41200773 CAATTCTGAGACTGTTTACCTGG - Intronic
1126186989 15:45840581-45840603 CAATTCTGACACTATCTACCTGG + Intergenic
1126323293 15:47447854-47447876 CAATTCTGGCAATGTCCACCTGG - Intronic
1126697459 15:51338418-51338440 CAGTTCCAACACTATCTACCTGG + Intronic
1127029346 15:54844832-54844854 CAGTTCTAACACTGTCTACCTGG + Intergenic
1127494126 15:59493611-59493633 CAATTCTCACTCTGTCTGCCAGG + Intronic
1127533266 15:59865543-59865565 CATTTCTGGCACTGTCTACCTGG - Intergenic
1127619252 15:60717122-60717144 CAATTCTAACACTGTTTACCTGG - Intronic
1127635706 15:60867386-60867408 CAATTCTGACACTATCTACCTGG - Intronic
1127796422 15:62442173-62442195 CAGTTCTGACACTATCCACCTGG - Intronic
1127890397 15:63245584-63245606 CAGTTCTGATACTGTCTACCTGG + Intronic
1127897375 15:63314070-63314092 CAATTCCAACACTGTCTGCCTGG + Intergenic
1128216143 15:65935459-65935481 CAATTCTGACACTATCTATCTGG - Intronic
1128624473 15:69185766-69185788 CAATTCTGGCACTGTCTACCTGG + Intronic
1128856187 15:71018689-71018711 TAATTCTGACACTGCCTACCTGG + Intronic
1128864537 15:71104424-71104446 CGATTTTGACACTGTCTACCTGG + Intronic
1129197291 15:73976413-73976435 CAATTCCAACACTATCTACCTGG - Intergenic
1129339850 15:74878563-74878585 TAATTCCAACACTTTCTACCTGG + Intergenic
1129576969 15:76760131-76760153 CAATTCTGACATTATCTACCTGG + Intronic
1129778732 15:78254805-78254827 CAATTCTGACACTGTCTACCTGG - Intergenic
1130074366 15:80675966-80675988 CAATTCTGACATGGTCTACCTGG - Intergenic
1130096439 15:80859655-80859677 CGATTCTGATACTGTCTACCTGG - Intronic
1130210853 15:81920130-81920152 CAATTCCAACACTATCTACCTGG - Intergenic
1131506576 15:93025125-93025147 CAAATCACACACTGTTCACCAGG - Exonic
1131921973 15:97338032-97338054 TAATTCTGACACTGTCTACCTGG + Intergenic
1132074165 15:98805894-98805916 CAGTTCTGACACTCACCACCTGG + Intronic
1132166228 15:99594069-99594091 CAATTCTGATACTATCTACCTGG + Intronic
1132366518 15:101261737-101261759 CAATTCTGACACTATCTACCTGG + Intergenic
1132723581 16:1328788-1328810 GAAGTCTAACACTGTCGCCCGGG + Intergenic
1133456488 16:5946778-5946800 CAATTCTGACATGATCCACCTGG - Intergenic
1135022795 16:18976936-18976958 CAATTCTGACACTATCTACCTGG - Intergenic
1135072153 16:19361680-19361702 CAATTCTGACACTAACAACCTGG + Intergenic
1135082894 16:19451679-19451701 CAATTCTGACACTATCTACCTGG + Intronic
1135091152 16:19519001-19519023 CAATTTTGACACTATCTACCTGG + Intronic
1135387068 16:22051846-22051868 CAATTCTGACACTGTCTACCTGG - Intronic
1135388598 16:22068896-22068918 CAATTCTGACACTAATCACCTGG + Intronic
1135412531 16:22245979-22246001 CAATTCTGACACCATCTACCTGG + Intronic
1135536549 16:23298946-23298968 TCATTCTAAAACTGTCCAACAGG + Intronic
1135679678 16:24445751-24445773 CAATTCTGACACTATGTACCAGG - Intergenic
1137281323 16:46979147-46979169 CAATTCTGACACTATCTACTTGG - Intergenic
1137372735 16:47923491-47923513 CAATTCTGATGCTGTCTACCTGG - Intergenic
1137373622 16:47932187-47932209 CAATTCTGACCCTATCTACCTGG + Intergenic
1137380431 16:47993440-47993462 CAATTCCAACAATAACCACCTGG - Intergenic
1137982283 16:53080095-53080117 CAATTCTGACACTAACTACCTGG - Intronic
1138206186 16:55126930-55126952 CAATTCTGTCACTGACTACCTGG + Intergenic
1138212533 16:55175395-55175417 CAATTCTGACACTATCTACCTGG + Intergenic
1138296408 16:55889275-55889297 CAGTTCTGACACTATCTACCTGG + Intronic
1138364365 16:56461680-56461702 CAATTCTGACACTATCTACCAGG - Intronic
1138464784 16:57181535-57181557 CAATTCTGACACTACCTACCTGG + Intronic
1138601344 16:58056490-58056512 CAATTCTTGCTCTGTCCCCCAGG - Intergenic
1139000736 16:62506708-62506730 CAATTCTGCCACTATCTACCTGG - Intergenic
1139177988 16:64713189-64713211 CAATTCTCATATTGTCTACCTGG + Intergenic
1139260041 16:65582791-65582813 CAATTTCCACACTGTCTACCTGG - Intergenic
1139637718 16:68268282-68268304 CAATCCCAACACTATCTACCTGG - Intronic
1139827737 16:69770730-69770752 CAGTTCCTACACTATCCACCTGG - Intronic
1140082611 16:71762971-71762993 CAATTCTGACACTGTCTCCCTGG - Intronic
1140530518 16:75661957-75661979 CAATTCCAGCACTGCCTACCTGG + Intronic
1140536691 16:75716255-75716277 CAATTCTGACACTATGTACCTGG + Intronic
1140835359 16:78788857-78788879 CAATCCTGACACTGTCTACGTGG - Intronic
1141078903 16:81033958-81033980 CAATTCCAACACTAACTACCTGG + Intergenic
1141385268 16:83616817-83616839 GGTTTCAAACACTGTCCACCTGG + Intronic
1143227428 17:5318278-5318300 TAATTCTGACACTATCTACCTGG - Intronic
1143259255 17:5585898-5585920 CAATTCTGACACTGACTGCCTGG + Intronic
1143378750 17:6482684-6482706 CAATTCTGCCTCTGTCTACCTGG - Intronic
1143398080 17:6618502-6618524 CAATTCTGACACTATCTCCCTGG - Intronic
1143540993 17:7568934-7568956 CAATTCCAACACTATCTACCTGG - Intronic
1144008979 17:11127415-11127437 CAATTCTGACACTATCTACCTGG + Intergenic
1144263719 17:13547861-13547883 CAATTCTGACACTATCTACCTGG - Intronic
1144335508 17:14265694-14265716 CAGTTCTGACACTATCTACCTGG + Intergenic
1144858353 17:18283620-18283642 CAATTCTGACACTATGCACCTGG + Intronic
1145086278 17:19943830-19943852 CAGTTCTCACACTGTTTACCTGG - Intronic
1145099795 17:20065245-20065267 CAACTCTGACGCTGTCTACCTGG + Intronic
1145895213 17:28453357-28453379 CAATTCTGACACTATCTGCCTGG + Intergenic
1147468858 17:40637979-40638001 CCATTCTCACACTGTCTACAGGG + Intronic
1147479032 17:40741425-40741447 CAATTCTAACACTAACACCCTGG - Intergenic
1147552261 17:41452068-41452090 CTATTTTCACATTGTCCACCTGG + Intergenic
1148937328 17:51173846-51173868 CAATTCTGATACTGTCTACCTGG - Intergenic
1148996931 17:51718735-51718757 CAATTCTGACACTATCTACTTGG - Intronic
1149185521 17:53992714-53992736 TAATTCCAACACTATCTACCTGG + Intergenic
1149268201 17:54950983-54951005 CAATTCCAACACCATCTACCTGG + Intronic
1149549740 17:57531584-57531606 GAATTCTAACACTGAACACCAGG - Intronic
1150101540 17:62428418-62428440 CAATTCTGACACTGTCTACTTGG + Intronic
1150257372 17:63758363-63758385 CAGTTCTGACACTATCTACCTGG - Intronic
1150573907 17:66413038-66413060 CAGTTCTGACGCTGCCCACCTGG + Intronic
1150883019 17:69052693-69052715 CAATTCTGACACTGTCTACTTGG + Intronic
1151247726 17:72807965-72807987 CAATTCTGACAGTATCCACCTGG - Intronic
1151255293 17:72871939-72871961 CAATTCTGCCACTGTGTACCTGG - Intronic
1152506628 17:80753693-80753715 GGATTGTATCACTGTCCACCAGG - Intronic
1153415147 18:4838225-4838247 CAATTCCAACACTGTCTACCTGG + Intergenic
1153509728 18:5838585-5838607 CAATTCTGACACAATCTACCTGG - Intergenic
1153841600 18:9012941-9012963 CAATCCAAACACCTTCCACCAGG + Intergenic
1153920698 18:9786567-9786589 CAATTCTGACACTCTCTCCCTGG - Intronic
1153926665 18:9840653-9840675 CAATTCAGACACTGACTACCTGG + Intronic
1154030230 18:10746924-10746946 CAATTCTACTACAGTACACCTGG - Intronic
1154084517 18:11290067-11290089 CAATTCTGACACTAGCTACCTGG + Intergenic
1154250327 18:12738708-12738730 CAGTTCTCACACGGTCCACATGG - Intergenic
1154974371 18:21442818-21442840 CCTTTCTGACACTATCCACCTGG - Intronic
1155171796 18:23272182-23272204 CAGTTCTGACACTATCTACCTGG - Intronic
1155240442 18:23859347-23859369 CACTTCTGACACTCTCTACCTGG + Intronic
1155613933 18:27700251-27700273 CAATTCTGACACTATCTCCCTGG + Intergenic
1156472448 18:37386013-37386035 CAATTCTAAATATGGCCACCAGG + Intronic
1157373445 18:47139709-47139731 CAGTTCCAACACTGTCTACCTGG - Intronic
1157689490 18:49669330-49669352 CCATTCAAACACTGTCAGCCAGG + Intergenic
1157698979 18:49747502-49747524 TAATTCTGACACTGTCTGCCTGG - Intergenic
1157739862 18:50082926-50082948 CAATTCTAACACTAACCACCTGG + Intronic
1157807322 18:50667864-50667886 CAATTCCAACACTATTTACCTGG + Intronic
1158573571 18:58616971-58616993 CAGTTCTGACTCTGTCCACCTGG - Intronic
1158881189 18:61780992-61781014 CAATTCCGACACTGTCTATCTGG - Intergenic
1159017694 18:63115028-63115050 CAGTTCCAACACTGTCTACCTGG - Intergenic
1159138107 18:64361028-64361050 CATATCTTACACTGTGCACCTGG - Intergenic
1159303633 18:66611526-66611548 TAATTCTGACACTGTCTACATGG + Intergenic
1159966686 18:74601764-74601786 TAATTCAATCACTGCCCACCAGG + Intronic
1161637628 19:5398977-5398999 CAGTTCTAAGACTCTACACCTGG + Intergenic
1161916220 19:7230417-7230439 GAATCCTAACAGTGTCCACCTGG + Intronic
1162000760 19:7743627-7743649 CAATCCTAAGCCTGTTCACCTGG + Intronic
1164522514 19:28989938-28989960 CCATTCTGACACCGTCTACCTGG - Intergenic
1164538162 19:29102111-29102133 CAATTCTGACACTGTCTAACTGG - Intergenic
1164612066 19:29639295-29639317 CAATTCTGACACCATCTACCTGG + Intergenic
1165401270 19:35602047-35602069 CAATTCTGACACTATCTACCTGG + Intergenic
1166634599 19:44439089-44439111 CAATTCTGACACTGTCTGCCCGG - Intronic
1166889909 19:45984740-45984762 CAATTATCACACTGTCCAACAGG - Intergenic
1167132131 19:47593847-47593869 CACTTCTGACACTATCTACCTGG - Intergenic
1167206221 19:48104424-48104446 CAATTCTGACGCTGGCTACCTGG - Intronic
1167287652 19:48607476-48607498 CCCTTCTAAGGCTGTCCACCAGG + Exonic
1167699640 19:51034925-51034947 CAACTCTACCACTCTGCACCTGG + Intronic
1167810431 19:51825002-51825024 AAATTCCAACACTATCTACCTGG + Exonic
1167842641 19:52134589-52134611 TAATTCTGGCACTGTCTACCTGG - Intronic
1167869438 19:52355543-52355565 CATTTCTAACACTGTCTACCTGG + Intronic
1167880674 19:52454789-52454811 CAATTCTTACACTATCTACAAGG - Intronic
1167957251 19:53075937-53075959 CCATTCTGACACTGTCTATCTGG - Intronic
1167966334 19:53150198-53150220 CAATTCTGACACTGTCTACCTGG - Intronic
1167967101 19:53156849-53156871 CAATTCTGAAACTCTCTACCTGG - Intronic
1167972724 19:53198467-53198489 CAATTCTGACACTGTGCGCCTGG + Intergenic
1168450019 19:56459041-56459063 CAATTCTGACACTGTCTACCTGG - Intronic
1168456096 19:56509602-56509624 CAATTCTGACACTATCTACCTGG - Intronic
1168578139 19:57530635-57530657 CTATTCTAACACTAACTACCTGG - Intronic
925939662 2:8804866-8804888 CAATTCTGACACTACCTACCTGG + Intronic
926022998 2:9513530-9513552 CAATTCAAACACTCTCCACCCGG - Intronic
926169132 2:10540032-10540054 CAATTCTGACACTATCTACCTGG - Intergenic
926322982 2:11761953-11761975 CAATTCTGACACCATCTACCTGG + Intronic
927198229 2:20562722-20562744 CAATTCTGACACTATCCCCCTGG - Intronic
927563279 2:24088869-24088891 CAATTCTGACACTCTCTACCTGG - Intronic
927593199 2:24374480-24374502 CAATTCTTACACTGTTTACCTGG - Intergenic
928061233 2:28115598-28115620 CGATTCTTGCTCTGTCCACCAGG - Intronic
928248479 2:29653088-29653110 CTATTCTGACACTATCTACCTGG - Intronic
928444706 2:31322664-31322686 CAATTCTGACACTAACTACCTGG - Intergenic
928619229 2:33071967-33071989 GAATTCTGACACTGTCTACCTGG + Intronic
929264008 2:39898533-39898555 CAATTCTGATACTATCTACCTGG + Intergenic
929530251 2:42746486-42746508 CAATTCTGACCATGTCTACCTGG + Intronic
929794546 2:45049059-45049081 AAACATTAACACTGTCCACCAGG - Intergenic
930745969 2:54884075-54884097 CTATTCTGACACTGTCTACCTGG + Intronic
931439013 2:62274161-62274183 CAATTCTGACATTATCTACCTGG - Intergenic
931829576 2:66036825-66036847 CAATTTTGACACTATCTACCTGG - Intergenic
931958084 2:67450857-67450879 CAATTCTGACACTATCTACTTGG + Intergenic
932045024 2:68339663-68339685 CAATTCTGACACTATCTACCTGG - Intergenic
933281859 2:80340760-80340782 CAATTCTGACATTATCTACCTGG + Intronic
933287675 2:80401924-80401946 CAATTCTAACACTATCTACCTGG + Intronic
933553791 2:83807592-83807614 AAATTCTGACACTGTCTACCTGG + Intergenic
933725875 2:85426918-85426940 CAATTCCAACACTACCTACCTGG - Intronic
934027097 2:88010299-88010321 CACTTCTCACACTCTCAACCTGG + Intergenic
934050545 2:88206849-88206871 CAATTCTAACACTATCTACCAGG - Intergenic
934106050 2:88695362-88695384 CAATTTCAACACTCTCTACCTGG - Intronic
934517368 2:94997170-94997192 CAATTCTGATACTGTCTACCCGG - Intergenic
935184321 2:100717955-100717977 CAATTCTAACACCATCTACCTGG + Intergenic
935235934 2:101138421-101138443 CAATTCTGACACTAACTACCTGG + Intronic
935535934 2:104294756-104294778 CAGTTCTGACACTATCAACCTGG + Intergenic
935654922 2:105413917-105413939 CAATTCTGACACTATCTACCTGG + Intronic
935985222 2:108666096-108666118 CAATTCCCACACTATCTACCTGG + Intronic
936002785 2:108850918-108850940 CACTTCTGACACGATCCACCTGG + Intronic
936117525 2:109713953-109713975 CAGTTCTGACACTATCTACCTGG + Intergenic
936137656 2:109909742-109909764 CAATTCCCACACTATCTACCTGG + Intergenic
936207041 2:110461743-110461765 CAATTCCCACACTATCTACCTGG - Intronic
936595174 2:113840591-113840613 CAGTTCCGACACTGTCTACCTGG - Intergenic
936602385 2:113910596-113910618 CAATTCCAATACTATCTACCTGG - Intronic
936859064 2:116994319-116994341 CAATTCTCACGCTATCTACCTGG + Intergenic
937115250 2:119400262-119400284 CAATTCTGGTACTGTCTACCTGG + Intergenic
937126838 2:119480441-119480463 CAATTCTATTACCTTCCACCAGG + Intronic
937631485 2:124106872-124106894 CAATTCTGACAGTATCTACCTGG - Intronic
937888746 2:126918851-126918873 ACATTCTAACACTAACCACCTGG + Intergenic
938643844 2:133311056-133311078 CAATTCTGACACGATCTACCTGG + Intronic
938708619 2:133955884-133955906 CAATTCTGACACTACCTACCTGG - Intergenic
938774711 2:134531394-134531416 CAATTCTGACACTACCCACTCGG + Intronic
938884199 2:135626115-135626137 CAATTCTGACACTCTATACCTGG - Intronic
939060995 2:137421260-137421282 CAATTCTAATACTGTCTATCTGG + Intronic
939162980 2:138610890-138610912 CAATTCTGACACTACCTACCTGG - Intergenic
939607927 2:144274952-144274974 CAATTCTGACAACATCCACCTGG - Intronic
940190806 2:151038086-151038108 CAATTCTGACACTGTCTACCTGG - Intronic
941310663 2:163926621-163926643 CAATTCTGATACTGTCTACCTGG - Intergenic
941872174 2:170397700-170397722 CAATTCTGACCCTCTCCACCTGG + Intronic
941881048 2:170480692-170480714 CAATTTGGACATTGTCCACCTGG - Intronic
942224341 2:173802255-173802277 CAATTTTGACACTATCCACCTGG + Intergenic
942676712 2:178434441-178434463 CAAGTCTAACTCTGTCACCCAGG + Intronic
942689582 2:178571366-178571388 CAGTTGTCACACTGTCCTCCAGG - Exonic
942745304 2:179225110-179225132 CAGTTCTAACACTGCCTACCTGG - Intronic
942857539 2:180567635-180567657 CAATTCTAACACTATCTCCTGGG - Intergenic
943311749 2:186334142-186334164 CAATTCTGACACTATCTAGCTGG - Intergenic
943468541 2:188262389-188262411 CAATTCTGACACTATCTACCTGG - Intergenic
943676663 2:190722176-190722198 CAATTCTGACACTCTCTACCTGG - Intergenic
944278038 2:197861676-197861698 CAATTGTGACACTCTCTACCTGG - Intronic
944504191 2:200392778-200392800 TAATTCTGACACTGTCTACCTGG - Intronic
944533712 2:200689413-200689435 CAATTCTGACCCTATCTACCAGG + Intergenic
944535618 2:200706980-200707002 CAATTCTGACACTCCCTACCTGG + Intergenic
944992661 2:205255468-205255490 CAATTCTGACACTATCTACCTGG + Intronic
945109737 2:206350760-206350782 CAATTCAATCACTTCCCACCAGG + Intergenic
945273254 2:207962686-207962708 CAGTTCTGTCACTGACCACCCGG - Intronic
945430140 2:209754485-209754507 CAATTCTGACACTATCTTCCTGG - Intergenic
945517631 2:210782772-210782794 CAATTCCAACACTATCTATCTGG + Intergenic
946497893 2:220214352-220214374 CAATTCTGACACTATTTACCTGG - Intergenic
946743720 2:222825842-222825864 CCATTCTGACACTATCTACCAGG + Intergenic
946984242 2:225253986-225254008 TAATTCTGACACTGACCTCCAGG - Intergenic
947294755 2:228618066-228618088 CAATTCTGACACTGTATACCTGG - Intergenic
947537706 2:230951231-230951253 CAATTCCAACACTGTCTACCTGG - Intronic
947791159 2:232870213-232870235 CAATGCAAACTCTGTCCTCCTGG - Intronic
947964416 2:234267487-234267509 CAATTCTGACACTATCTGCCTGG - Intergenic
948065709 2:235077411-235077433 AAATTCTAACACTCTCTACTGGG + Intergenic
948389692 2:237603021-237603043 CAATTCTAACACTGTCCACCTGG - Intergenic
1168918707 20:1513178-1513200 CAATTCAATCACTTCCCACCAGG + Intergenic
1169031421 20:2410667-2410689 CAATTCTAACAGTAGCTACCTGG - Intronic
1169319338 20:4618476-4618498 CAATTCTGACACTTTCTACTTGG + Intergenic
1169415078 20:5409210-5409232 CAATTCTGACACTATCTACCTGG + Intergenic
1170016536 20:11787986-11788008 CAATTCTGACGCTATCTACCTGG - Intergenic
1170123658 20:12938146-12938168 CAATTCTGACACTGTCTACCTGG + Intergenic
1170254325 20:14323124-14323146 TAATCCCAACACTGTCTACCTGG + Exonic
1170653956 20:18268551-18268573 CAATTCTGACACTATTCACCTGG - Intergenic
1171403977 20:24897483-24897505 CATTTCCAACCCTGTCTACCTGG + Intergenic
1172354830 20:34272405-34272427 CAATTCCAACACTATCTACTTGG + Intergenic
1172398325 20:34626250-34626272 TTTTTCTAACACTATCCACCTGG - Intronic
1172411058 20:34723256-34723278 CAATTCTGACACTATCTGCCTGG - Intronic
1172655911 20:36538133-36538155 CGAGTCTCACTCTGTCCACCAGG + Intergenic
1173246309 20:41340173-41340195 CAATACTGACACTGGCCAGCAGG - Intergenic
1174687168 20:52467146-52467168 CAATTCTGACACTATCTACCTGG + Intergenic
1174934381 20:54851820-54851842 CAATTCTGATACTATCTACCTGG + Intergenic
1175096467 20:56545132-56545154 CAATTCTGACACTACCTACCTGG - Intergenic
1175449015 20:59046547-59046569 CAATTCCAACACCATCTACCTGG - Intergenic
1175697385 20:61112632-61112654 CAATTCTGACATTCTCCACCTGG - Intergenic
1177029725 21:15967591-15967613 CAATTCTGACACTATCTACCTGG - Intergenic
1177296008 21:19176779-19176801 CAAATATAACACTGTCAGCCAGG + Intergenic
1177557743 21:22714323-22714345 CAATTCCAACACTGTCTACCTGG - Intergenic
1178421124 21:32444236-32444258 CAATTCTGACACCATCTACCTGG + Intronic
1178529421 21:33362790-33362812 TAATTCTGACACTGTCTACCTGG - Intergenic
1178549345 21:33522689-33522711 CAATTATAATGCTGTGCACCCGG + Intronic
1178775189 21:35543165-35543187 CAATTCTGACACTAACTACCTGG - Intronic
1179042920 21:37820396-37820418 CAATTCTGACACTAACCACCTGG + Intronic
1179607360 21:42525405-42525427 CAATTCTCACACTGTCTTCCAGG - Intronic
1180889684 22:19277794-19277816 CAATTCTGACAATATCTACCTGG + Intronic
1181332839 22:22107573-22107595 CAATTCTGACACTATCCACATGG + Intergenic
1181588524 22:23868084-23868106 CCATTCTGACACTATCCACCTGG - Intronic
1181692158 22:24569571-24569593 CAGTTCTGACACTATCTACCTGG + Intronic
1181884181 22:26006404-26006426 CAATTCTAAAACTTTTCAACAGG - Intronic
1182052871 22:27326372-27326394 GAATTCTGACACTGTCTACCTGG - Intergenic
1184125046 22:42481052-42481074 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184133261 22:42530513-42530535 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184334228 22:43844001-43844023 CAATTCCAGCACTGCCCACCTGG - Intronic
1184367550 22:44062214-44062236 CAATTCTGACACCATCGACCTGG + Intronic
1184429756 22:44435127-44435149 CAATTCTAGCATTATCTACCTGG - Intergenic
1184575218 22:45358430-45358452 CAATTCTGACACTGTCTACCTGG - Intronic
1184593237 22:45499693-45499715 CAAGTCTCACACTGTCACCCAGG - Intergenic
951487612 3:23231591-23231613 CAATTCTGACACTCTCTACCTGG + Intronic
951513240 3:23528092-23528114 CAATTCTGATACTATCCACCTGG - Intronic
951578949 3:24141921-24141943 AAATTCTAACACAGTACACTTGG - Intronic
952773565 3:37023299-37023321 TAATTCCAACACTGTCTACTTGG + Intronic
953082958 3:39638295-39638317 CAATTCTTACACTATCTACCTGG + Intergenic
953222072 3:40980582-40980604 CAATTCCGACACTATCTACCTGG - Intergenic
953797571 3:45997179-45997201 CAATTCCGACACTATCTACCTGG + Intergenic
954565832 3:51599082-51599104 CAATTCTAACACTATCTACCTGG - Intronic
954977989 3:54715036-54715058 CAGTTCTGACACTATCTACCTGG + Intronic
955320184 3:57968730-57968752 CAATTCTGACACCATCTACCTGG - Intergenic
955378136 3:58415230-58415252 CAATTCTGACACTATCTACCTGG + Intronic
955719454 3:61866061-61866083 CAATTATAAAACTGTCCCACAGG - Intronic
956212304 3:66814495-66814517 CAATTCTGACACTATCTACCTGG + Intergenic
956381143 3:68665695-68665717 ATATTCTGACACTGTCTACCTGG + Intergenic
956708103 3:72016708-72016730 CATTTCTGACACTATCTACCTGG - Intergenic
956905649 3:73762522-73762544 CAATTCTGACACTATCTACTTGG + Intergenic
957050271 3:75406302-75406324 CAATTCTGACACCATCTACCTGG - Intergenic
957670993 3:83302769-83302791 TAATTCCAACACTATCTACCTGG + Intergenic
958095867 3:88943230-88943252 CAATTCTGACACTATCTACCTGG - Intergenic
959228427 3:103616407-103616429 CAATTCTGACACTATCTACCTGG - Intergenic
960829536 3:121831609-121831631 CAATTCTGACACTGTCTACTTGG - Intronic
961072282 3:123944097-123944119 CAATTCCAACACTATCTACCTGG - Intronic
961100026 3:124190840-124190862 CAATTCTGACATTATCTACCTGG + Intronic
961173142 3:124813382-124813404 CAATTCTGACACTATCTACCTGG + Intronic
961237981 3:125384994-125385016 CAATTCTGACACAATCTACCTGG + Intergenic
961585281 3:127917119-127917141 CAATTCTGACACCATCTACCTGG + Intronic
961841708 3:129719598-129719620 CAATTCTGACTCTGTCTACCTGG - Intronic
961855794 3:129869566-129869588 CAATTCTGACACTGTCTACCTGG - Intronic
961882581 3:130072740-130072762 CAATTCTGACACCATCTACCTGG - Intergenic
962194801 3:133352420-133352442 CAATTTTTATACTGTCTACCTGG + Intronic
962447155 3:135476554-135476576 CAATTCTGACACTATCTACCTGG - Intergenic
962712621 3:138100611-138100633 CAATTCTGACACTATCTACCTGG - Intronic
962996930 3:140638605-140638627 CATTTCTCATACTATCCACCAGG - Intergenic
963167736 3:142222734-142222756 AGATTCTAACTCTGTCCCCCAGG - Intronic
963538307 3:146555939-146555961 CAATTCTTACACTGTCCACCTGG + Intergenic
963756553 3:149240236-149240258 CAATTTTGACACTATCTACCTGG - Intergenic
964113859 3:153114850-153114872 CAATTCAAACTCTCCCCACCTGG + Intergenic
964240390 3:154585921-154585943 CAACTCTGACACTGTCTACCTGG - Intergenic
964502599 3:157365503-157365525 CAATCCTAACACTAACGACCTGG + Intronic
964519939 3:157554166-157554188 CAATTCTGACACTGTCTACCTGG - Intronic
964704431 3:159602918-159602940 CAACTCTGACACTCTCCACCTGG + Intronic
964800790 3:160555090-160555112 TAATTCTGACACTGTCTACCTGG - Intronic
964914026 3:161817713-161817735 CAATTCTGACACCATCTACCTGG + Intergenic
965346342 3:167555610-167555632 CTATTCTGACACTGTCTACTTGG - Intronic
965542872 3:169888173-169888195 CAAGTCTCACTCTGTCCCCCAGG + Intergenic
965843669 3:172937049-172937071 CAATTCTGACACTAACTACCTGG - Intronic
965867612 3:173224809-173224831 CAATTCTAACACTATCTGCCTGG + Intergenic
966694822 3:182778826-182778848 CAATTCTGACACTATTTACCTGG + Intergenic
967195503 3:187022187-187022209 CAGTTCCAACACTATCTACCTGG - Intronic
967469914 3:189849409-189849431 CAACTGTGACACTGTCTACCCGG - Intronic
967594703 3:191315477-191315499 CAATTCCGACACTATCTACCTGG - Intronic
969128339 4:4971427-4971449 CAATTCTGACATAGTCTACCTGG + Intergenic
970071205 4:12161983-12162005 CAATTCTAAGACTTTACACTTGG - Intergenic
970553920 4:17212715-17212737 CAATTCTCACTCTGTCACCCAGG + Intergenic
970628905 4:17920189-17920211 CAATTCTGATACTATCTACCTGG - Intronic
970994135 4:22246315-22246337 CAATTCTGACACTATTTACCTGG - Intergenic
971017446 4:22503119-22503141 CCAGCCTAACACTGTCCACTGGG + Intronic
971363344 4:25956427-25956449 CAATTCTGACACTATCTACCTGG - Intergenic
971514515 4:27469457-27469479 CAATTCTGACATTATCTACCTGG - Intergenic
971640538 4:29126435-29126457 CAATTCTGACACTATCTACTCGG - Intergenic
971806004 4:31358147-31358169 CAATTCTGACACCATCTACCTGG - Intergenic
971915583 4:32866421-32866443 TAATTCTAACACTGTCTACCTGG - Intergenic
972403523 4:38726253-38726275 CAAATTTAGCACTGTCCACCTGG - Intergenic
972575925 4:40351304-40351326 GAAGTCTCACACTGTCCCCCAGG - Intronic
973078057 4:45955545-45955567 CAATTCCAACACTATCTATCTGG + Intergenic
973229976 4:47829633-47829655 CAATTCTGACACTATCTACCTGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973755396 4:54068752-54068774 CAATTCCAGCACTCTCTACCTGG + Intronic
973919466 4:55670306-55670328 CAATTTTAACACTATCTACCTGG + Intergenic
974191742 4:58513385-58513407 CAATTCTCTCACTGTACACTTGG + Intergenic
974450977 4:62058833-62058855 TAATTCTAATACTGTCTTCCAGG - Intronic
976044620 4:80930532-80930554 TAATTCTGACACTATCTACCTGG - Intronic
976213659 4:82695105-82695127 TAATTCTGACACTAACCACCCGG - Intronic
976282724 4:83341201-83341223 CAGTTCTGACACTATCTACCCGG + Intergenic
976657783 4:87507689-87507711 GAATTCTGACACTGTGTACCTGG + Intronic
977235690 4:94505164-94505186 CAATTCTGACACTACCTACCTGG + Intronic
977357511 4:95966239-95966261 CAATTCTGACAGTATCTACCTGG + Intergenic
977401771 4:96541561-96541583 CAATTCTGACACTATCTACCTGG - Intergenic
977476183 4:97512927-97512949 CAATTCTGACACTATCTACCTGG + Intronic
977563534 4:98558363-98558385 CAAGTCTCACACTGTCCCCCTGG + Intronic
977718410 4:100209755-100209777 CAATTCCTACACTATCTACCTGG - Intergenic
978162399 4:105564748-105564770 CAAAAGTAACACTGTCCTCCAGG - Intronic
978232077 4:106411984-106412006 CAATTCTGACACTATATACCTGG + Intergenic
978723383 4:111941376-111941398 CAGTTCTGACACTATCTACCTGG - Intergenic
978846969 4:113285297-113285319 CAGTTCTAACACTGTCTATCTGG + Intronic
980636632 4:135514103-135514125 TAATTTCAACACTGTCCAGCTGG - Intergenic
980922812 4:139103693-139103715 CAGTTCTGACACTGTCTACTTGG - Intronic
981742418 4:148016672-148016694 CAGTTCCAACACCGTCTACCTGG + Intronic
981847305 4:149184317-149184339 CACTTCTAACACTATCTACCTGG - Intergenic
981907856 4:149943147-149943169 CAATTCTGACACTGTCTGCCTGG - Intergenic
982360719 4:154516067-154516089 CAATTCTGACACCATCTACCAGG - Intergenic
982798682 4:159674686-159674708 CAGTTCTGACACTATCTACCTGG - Intergenic
982865559 4:160505891-160505913 TAATTCTGACACTATCTACCCGG - Intergenic
983052911 4:163069568-163069590 CAATTCTGATACTATCTACCTGG - Intergenic
983768589 4:171519227-171519249 CAACTCTGACACTATCTACCTGG + Intergenic
984232512 4:177115748-177115770 CAATTCTGACACTGTCTACCTGG - Intergenic
984888215 4:184469647-184469669 AAAGTCTCACTCTGTCCACCAGG - Intronic
984904137 4:184611238-184611260 CAATTCTGACGCCATCCACCTGG + Intergenic
984905441 4:184621632-184621654 CAATTCTAACACTATCTACCTGG - Intergenic
985139214 4:186821805-186821827 CAGTTCCAATGCTGTCCACCTGG + Intergenic
986147182 5:5089301-5089323 CAATTCTGACACTATCTATCTGG - Intergenic
987252046 5:16109793-16109815 CAATTCTGACACAGTTGACCTGG - Intronic
987336814 5:16904517-16904539 CAGTTCTGACACTGTCTACCCGG - Intronic
987394851 5:17413346-17413368 TAATTCTGACACTGGTCACCAGG + Intergenic
987719579 5:21616684-21616706 CAATTCGGACACTGTCTACCTGG - Intergenic
987736449 5:21850013-21850035 CACTTAGAACACTGTCCCCCAGG - Intronic
988280796 5:29143925-29143947 CAATTCTGACACTGCCAACCTGG - Intergenic
988494547 5:31733908-31733930 CAATTCTGACACTGTCTACCTGG + Intronic
989309696 5:40000168-40000190 CAGTTCTGACACTGTCCACCTGG - Intergenic
989512879 5:42309033-42309055 CAATTCTGACACTATCTATCTGG + Intergenic
989739541 5:44753932-44753954 CAATTCTGACAGTATCTACCTGG - Intergenic
990081182 5:51915515-51915537 CAATTCTGATGCTGTCTACCAGG - Intergenic
990306011 5:54494481-54494503 CAGTTCTGACATTGTCTACCTGG - Intergenic
990405423 5:55485255-55485277 CAATTCTGACACTAACCACCTGG - Intronic
990604506 5:57395384-57395406 CAAATCTGACACTGTCTACTGGG + Intergenic
990775393 5:59300727-59300749 CAGTTCCAACGCTGTCTACCTGG + Intronic
990866670 5:60387819-60387841 CAATTCTGCCACTATCTACCTGG + Intronic
991697750 5:69288806-69288828 CAATTCTCACACTGTCTACCTGG - Intronic
991995242 5:72379963-72379985 CAGTTCTGACACTGTCTACCCGG - Intergenic
992144886 5:73835840-73835862 CAATTCTGGCACTATCGACCTGG - Intronic
992212281 5:74492733-74492755 CAATTCTGACACTGTCTACCTGG + Intergenic
992295270 5:75321330-75321352 CAATTCTAATACTATTTACCTGG + Intergenic
992395951 5:76369860-76369882 CAATTCTGACACTGTCTACCTGG + Intergenic
993189880 5:84668599-84668621 CAATTCCAACACTATCTACCTGG - Intergenic
993383283 5:87232742-87232764 CAATCCTAACACTGTGTACCTGG - Intergenic
993485415 5:88478545-88478567 AAATTCTACCTTTGTCCACCTGG + Intergenic
993715201 5:91269280-91269302 CAATTCTGACACTATCTACCTGG - Intergenic
993810499 5:92470438-92470460 CAATTCCAACACAATCTACCTGG + Intergenic
994227028 5:97264901-97264923 CAATTCCAACACCATCTACCTGG + Intergenic
994369013 5:98947984-98948006 CAATTCTGACACTATCTACCTGG - Intergenic
994520746 5:100831439-100831461 CAATTCTAAAACTTCCCACCTGG + Intronic
995599540 5:113780501-113780523 CAATTCTGACACTATCTCCCTGG - Intergenic
995742926 5:115373987-115374009 CAAACCTAGCACTGGCCACCTGG + Intergenic
995800900 5:115993439-115993461 CATTTCTTAAACTGTCCACTTGG - Intronic
996568834 5:124910385-124910407 CAATTCTGACACTATCTAACTGG - Intergenic
996623290 5:125537521-125537543 CAGTTCTGACACTGTCTATCTGG + Intergenic
996707705 5:126513766-126513788 CAATTCCAACACTGTCTACTCGG - Intergenic
997428941 5:133824163-133824185 CAGTTCTGACACTGTCTACCTGG + Intergenic
997650956 5:135520241-135520263 CGATTCTGACACTGTCTACCTGG + Intergenic
997838025 5:137212155-137212177 TAATTCTGTCACTGTCTACCTGG - Intronic
997841001 5:137239591-137239613 CAATTCTGACACTATCCACTTGG - Intronic
998093987 5:139387024-139387046 CAATTCTGGCACTATCTACCTGG - Intergenic
998329263 5:141309468-141309490 CAATTCCAACACTATCTACCTGG + Intergenic
998605680 5:143632427-143632449 CAGTTCTAACACTATCTATCTGG + Intergenic
998646643 5:144069363-144069385 CAATTCTAACACTATCTACTTGG - Intergenic
998777936 5:145623853-145623875 CAATTCTGACACTGTCTGCCAGG + Intronic
999392744 5:151206026-151206048 CAATTCTGACACTATCTACCTGG + Intronic
999432427 5:151535793-151535815 CAATTCCAACACTATCTACCTGG - Intronic
999712181 5:154328593-154328615 CAATTCTGACACTACCTACCTGG + Intronic
999773240 5:154791237-154791259 CAATTCTCACTCTGTCACCCAGG + Intronic
999990786 5:157047925-157047947 CAGTTCTTACACTGTCTACCCGG - Intronic
1000416434 5:160988579-160988601 CAATTCTGACACTATCCACCTGG - Intergenic
1000580660 5:163031813-163031835 CAATTCTGACACTATCTACCTGG - Intergenic
1000813569 5:165891791-165891813 CAATTCTGACACTGATTACCTGG - Intergenic
1000984213 5:167849535-167849557 CAATTCTGACACTATCTACCTGG + Intronic
1001489730 5:172146892-172146914 CAATTCCGACACTATCTACCGGG + Intronic
1001582698 5:172809709-172809731 CAATTTCAACACTATCTACCTGG - Intergenic
1001674032 5:173497759-173497781 CAGTTCTCACTCTGTCCCCCAGG - Intergenic
1001703479 5:173724222-173724244 CAATTCTGACAGTATCTACCTGG + Intergenic
1001755223 5:174163493-174163515 CAATTCCGACACTATCAACCTGG + Intronic
1001945013 5:175771597-175771619 CATTTCTAACACTAACTACCTGG + Intergenic
1002124245 5:177029942-177029964 CAATTCTGACACTATCTACCTGG - Intronic
1002356245 5:178631501-178631523 CAATGATAACACAGTCAACCAGG - Intergenic
1002544090 5:179926859-179926881 CAGTTCCAACGCTGTCTACCTGG - Intronic
1002557871 5:180057980-180058002 CAATTCTGACACTAACTACCTGG - Intronic
1002626405 5:180532630-180532652 CAATTCCAACACTGTCTTCCTGG + Intronic
1002659791 5:180783861-180783883 CAGTTCCAACCCTGTCTACCTGG - Intergenic
1002668896 5:180849070-180849092 CAATCATAAAAGTGTCCACCAGG - Exonic
1002837793 6:879892-879914 CAATTCTGACACCCTCCACCTGG - Intergenic
1002857369 6:1050301-1050323 CAATTATAACACTCTCCACCTGG + Intergenic
1003238321 6:4318421-4318443 CAATTCTGACACCATCTACCTGG - Intergenic
1003324475 6:5082268-5082290 CAATTCTGACATTATCTACCTGG - Intergenic
1003391418 6:5716567-5716589 CAGTTCTGACACTGTCTACCTGG + Intronic
1003507795 6:6753769-6753791 CAATTCTGACACCATCTACCTGG - Intergenic
1003610866 6:7614052-7614074 CATTTCTGACATTGTCTACCTGG + Intergenic
1004278189 6:14256640-14256662 CAATTCCAACACTCCCTACCTGG + Intergenic
1004394401 6:15235505-15235527 CAATTCCAACACTATCCACCTGG + Intergenic
1004590956 6:17051037-17051059 CAATTCCGACACTGTCTGCCTGG - Intergenic
1004699695 6:18067321-18067343 CAATTCTGACGCTATCCACCTGG - Intergenic
1005152905 6:22772926-22772948 CAATTCCAACACCGTCTACCGGG - Intergenic
1005222483 6:23602433-23602455 CAATTCCGGCACTGTCTACCTGG - Intergenic
1005680490 6:28202811-28202833 CAATTCTGACACTATCTACCTGG + Intergenic
1005716002 6:28549261-28549283 CAATTCTGACATTATCCACCTGG + Intergenic
1005879565 6:30045507-30045529 CAATGTCAACACTGTCTACCTGG + Intergenic
1005924304 6:30429480-30429502 CAATTCTGACACTATCTCCCTGG + Intergenic
1006041896 6:31263061-31263083 CAATTCTGACACTAACTACCTGG - Intergenic
1006051550 6:31348953-31348975 CAATTCTGACACTAACTACCTGG - Intronic
1006369832 6:33637142-33637164 CAATTCTGACACTATCTGCCTGG + Intronic
1006497790 6:34436426-34436448 CAATTCCCACACTATCTACCTGG + Intergenic
1006723792 6:36181011-36181033 TGATTCTGACACTATCCACCCGG + Intergenic
1006962632 6:37949473-37949495 CAATTCTGACACTATCTACCTGG + Intronic
1007134347 6:39507225-39507247 CAATTCTGACACTGTCTACCTGG - Intronic
1007535844 6:42588019-42588041 CAACTCTGACCCTGTCTACCAGG + Intronic
1007674795 6:43584612-43584634 CAATTCCAACACTGTCTACCTGG + Intronic
1007801355 6:44396605-44396627 TAACTCTAATACTGTCTACCTGG + Intronic
1008119347 6:47593062-47593084 CAATTCTGACACTGTCTTTCTGG - Intronic
1008357119 6:50568110-50568132 CAATTCTGACACTATCTACCTGG + Intergenic
1008586800 6:52958117-52958139 TAATTCTGACACTATCCACCCGG + Intergenic
1008656510 6:53619441-53619463 CAATTCTGACACTATCTATCTGG + Intergenic
1008897719 6:56576492-56576514 CAATTCTGACACTGTCTACCTGG - Intronic
1009462621 6:63932803-63932825 CAATTCTGACACTATTTACCTGG + Intronic
1009833130 6:68964756-68964778 TATATATAACACTGTCCACCAGG + Intronic
1009927233 6:70134867-70134889 CAATTCTGACACTATTTACCTGG + Intronic
1010023905 6:71193644-71193666 CAATTCTGACACAGTCTACCTGG - Intergenic
1010238087 6:73591665-73591687 CAGTACTGACACTGTCTACCTGG + Intergenic
1010240968 6:73615077-73615099 CAGTTCTGACACTGTCCAGCTGG - Intronic
1010426482 6:75733892-75733914 CAATTCTGACACTGTCTACCTGG - Intergenic
1010495297 6:76527700-76527722 TAATTCTAACACTGCTCATCAGG - Intergenic
1010588739 6:77687476-77687498 CAATTCTGACACTAACTACCTGG + Intergenic
1010765281 6:79771836-79771858 CAATTCCGACACTATCTACCTGG + Intergenic
1011337239 6:86275023-86275045 CAATTTTCACACTGTCTATCTGG - Intergenic
1011381113 6:86743186-86743208 CAATTCTGACACTGTCTACCTGG + Intergenic
1011415525 6:87115939-87115961 CAATTCTGACACTATCTATCTGG - Intergenic
1013071916 6:106737293-106737315 TAATTCTGACACTGTCTACCTGG + Intergenic
1013438859 6:110140566-110140588 CAATTCTGACACTATCTACCTGG - Intronic
1013510477 6:110840278-110840300 CAATTCCGACACTGTCTACCTGG + Intronic
1013997114 6:116321747-116321769 GGAGTCTCACACTGTCCACCCGG - Intronic
1014107568 6:117584273-117584295 CAATTTTGACACTATCTACCTGG + Intronic
1014649469 6:124017833-124017855 AAATGCTCACACTGTGCACCTGG - Intronic
1015593422 6:134843719-134843741 CAATTCCAACACTATCTACCTGG - Intergenic
1015976659 6:138797790-138797812 CAGTTCTGACACTGTGTACCTGG + Intronic
1016181677 6:141154612-141154634 CTATTCTGACCCTGACCACCTGG - Intergenic
1016207756 6:141490597-141490619 CAATTCCCACACTCTCTACCTGG + Intergenic
1016286711 6:142481630-142481652 CAACTCTGACACTATCCACCTGG - Intergenic
1016951742 6:149587316-149587338 CAGTTCTGACACTTTCCACCTGG + Intronic
1017038193 6:150285897-150285919 CAGTTCTGACACTGTTGACCTGG - Intergenic
1017123906 6:151048929-151048951 CAATCCTGACACTGTCTACCTGG + Intronic
1018011967 6:159678805-159678827 CAATTCTGACACTGTCTACCTGG - Exonic
1018340996 6:162850948-162850970 CAGTCCTGACACTGTTCACCTGG - Intronic
1018411290 6:163551289-163551311 CTGTTCTGACGCTGTCCACCTGG + Intronic
1018854599 6:167666547-167666569 CAATCCTGACGCTGTCCAGCTGG - Intergenic
1019450109 7:1093185-1093207 CATTTCTGACACCGTCGACCAGG + Exonic
1019635287 7:2072179-2072201 CTGTTCTGACACTGTCTACCTGG - Intronic
1019682583 7:2359776-2359798 CAATTCAGACACTATCTACCAGG - Intronic
1019855076 7:3597244-3597266 CAAGTCTTACTCTGTCGACCAGG - Intronic
1020264882 7:6553647-6553669 CAATGCTCACCCTGGCCACCAGG - Intergenic
1020334635 7:7053186-7053208 CAGTTCCAACACTATCTACCTGG - Intergenic
1020616072 7:10464389-10464411 CAATTCAATCACTTTCCACCAGG - Intergenic
1021991552 7:26146206-26146228 CAATTCTGACACTATCTGCCTGG - Intergenic
1022833725 7:34094089-34094111 CACTTCTATCACTGTCCACTCGG + Intronic
1023314132 7:38917652-38917674 CAATTCTGATACTAACCACCCGG - Intronic
1023375716 7:39553013-39553035 CAATTCTGACACTATCTACCTGG - Intergenic
1023428723 7:40067516-40067538 CAATTCTCACTCTGTCACCCAGG - Intronic
1024042030 7:45563387-45563409 CAATTCTGACACTATCTAGCTGG - Intergenic
1024340177 7:48249893-48249915 CAATTCTCGCACTGTCTGCCTGG + Intronic
1024445311 7:49470772-49470794 TAATTCTGACACTATCTACCTGG - Intergenic
1024851778 7:53726108-53726130 CAATTCTGACACTGTCTCTCAGG - Intergenic
1024901995 7:54330086-54330108 CAATTCTGACTCTATCTACCTGG + Intergenic
1025724786 7:64046420-64046442 TAATCCAAACACTTTCCACCAGG - Intronic
1026107621 7:67433491-67433513 CAATTCTGACACTCACTACCTGG + Intergenic
1026128531 7:67600902-67600924 CAATTCTAGCTCTGTCATCCTGG - Intergenic
1026836334 7:73641933-73641955 CAATTCTGACACTATTTACCTGG + Intergenic
1027785874 7:82577939-82577961 CAATTCTGACATTATCTACCTGG - Intergenic
1029036623 7:97529267-97529289 CAATTCTCACCCTGTCTAACTGG + Intergenic
1029840062 7:103352828-103352850 GCATTCAAACCCTGTCCACCTGG + Intronic
1030780867 7:113598140-113598162 CAATTCCAATACTGTCTACCTGG - Intergenic
1031694078 7:124827451-124827473 CAATTCTGACACTATCTACCTGG - Intronic
1031928931 7:127664779-127664801 CAATTCAGACACTGTCTTCCTGG - Intronic
1032030689 7:128481277-128481299 CAATTCTGACACTGTCTACTTGG + Intronic
1032913700 7:136462869-136462891 CAACTCTGACACTATCTACCCGG - Intergenic
1033082961 7:138315056-138315078 CAATTCTGACACTCTCTACCTGG + Intergenic
1033147807 7:138885947-138885969 CAGTTCCGACACTGTCCACTGGG - Intronic
1033197208 7:139338067-139338089 TAATTCTATCACTGTACACTCGG + Intergenic
1033368986 7:140692101-140692123 CAATGCTAACACTATGCATCTGG - Intronic
1033458693 7:141525618-141525640 CAATTCTGATACTGCCTACCTGG - Intergenic
1033539585 7:142344545-142344567 AAATGCTAACACTTTCCTCCTGG + Intergenic
1033661584 7:143406661-143406683 CAGTTCTTACACTATCTACCTGG - Intronic
1033738082 7:144244460-144244482 CAATTCTGACACTATCTACTGGG - Intergenic
1033744973 7:144306497-144306519 CAATTCTGACACTATCTACTGGG + Intergenic
1033905939 7:146203198-146203220 CAATTCTAACACTATCCATCTGG + Intronic
1034561162 7:151880035-151880057 CATTTCTGACACTGTCTACCTGG - Intergenic
1035192435 7:157183172-157183194 CAATTCTGATGCCGTCCACCCGG + Intronic
1037264777 8:17046245-17046267 CAATTCTGACACTGTGTACCTGG - Intronic
1037442028 8:18926798-18926820 CATTTCCAACACTATCTACCCGG + Intronic
1037558832 8:20054272-20054294 CAATTCTGACATTGTCTACCTGG + Intergenic
1038298829 8:26323381-26323403 CAGTTCCAACACTGTCTACCTGG + Intronic
1038405621 8:27320345-27320367 CAATTCAGACACTATCTACCTGG + Intronic
1038896292 8:31786464-31786486 CTACTCTGACACTGTCTACCTGG + Intronic
1039229761 8:35430612-35430634 CAATTCCAACACTATCTACCTGG - Intronic
1039343497 8:36677148-36677170 AAAATATACCACTGTCCACCAGG + Intergenic
1040946219 8:52887139-52887161 CAAGTTTAACACTATCTACCTGG - Intergenic
1040969025 8:53113925-53113947 CAGTTCTGACACAGTCTACCTGG - Intergenic
1041799128 8:61779660-61779682 CAATTCTGACACTATCTACCTGG + Intergenic
1042036889 8:64542655-64542677 CAATTCTGACACTATCTACTTGG - Intergenic
1042149660 8:65768027-65768049 CAGTTCCAACACTGTCTACCTGG - Intronic
1043361117 8:79473483-79473505 CCTTTCTAACTCTGTCCTCCTGG - Intergenic
1043528266 8:81120232-81120254 CAATTCTGACACTAACTACCCGG - Intergenic
1044567267 8:93677863-93677885 AAAGTCTCACACTGTCCCCCAGG - Intergenic
1044581529 8:93830528-93830550 CAATTCTGACACTATCTATCTGG - Intergenic
1044945590 8:97385920-97385942 CAATTCTGATACTATCTACCTGG - Intergenic
1045347762 8:101310118-101310140 CAATTCTGACACTATGTACCTGG + Intergenic
1045473297 8:102532075-102532097 CAATTCTGACACCATCTACCTGG + Intronic
1045911521 8:107416137-107416159 CAAACCTGACACTGTCCACCTGG + Intronic
1045991599 8:108314803-108314825 CAATTCTGACACTGTTTACCTGG - Intronic
1046219241 8:111192311-111192333 CAATTCTGACACAGTCTACCTGG + Intergenic
1046362734 8:113183939-113183961 CAATTCTGACATTGTCTACCTGG + Intronic
1046405823 8:113770532-113770554 TAATTCCATCACTTTCCACCAGG - Intergenic
1047399583 8:124534690-124534712 CAATTCTCACACTATCTACCTGG + Intronic
1047968446 8:130064666-130064688 CAATTCTGACACCATCTACCTGG + Intronic
1048191453 8:132293374-132293396 CAATTCTGACACCATCTACCTGG - Intronic
1048413640 8:134202159-134202181 CAACTCTAACACTAACTACCTGG - Intergenic
1048831174 8:138478864-138478886 CAATTCTGACACTAACCGCCTGG + Intronic
1049161230 8:141099284-141099306 CAATTCCAACACCATCCACCTGG + Intergenic
1049729875 8:144171094-144171116 CAATCCCAACACCATCCACCTGG + Intronic
1049821382 8:144635748-144635770 CAGTCCTCACACTGTCTACCTGG - Intergenic
1049934308 9:485843-485865 CAATTCTCACTCTGTCACCCAGG - Intronic
1049966426 9:784418-784440 CAACTCCAACACTCTCTACCTGG + Intergenic
1050263271 9:3863411-3863433 TAATTGCAACACTGTCCACTGGG + Intronic
1050418288 9:5436948-5436970 AAATTCTAACACTTTTCACCAGG + Intronic
1050434379 9:5593407-5593429 CACTTCTGACCCTGTCTACCTGG - Intergenic
1050460677 9:5874933-5874955 CAACTCCAACACTATCTACCTGG - Intergenic
1050988368 9:12112941-12112963 CAATTCTGACACTAACTACCTGG + Intergenic
1052508957 9:29390127-29390149 CAATTCTGACACTACCTACCTGG + Intergenic
1052614886 9:30825602-30825624 TAATTCTCACACTATCTACCTGG + Intergenic
1052798771 9:32948368-32948390 TAACTCTGACACTATCCACCTGG + Intergenic
1052817032 9:33109749-33109771 CAATTCTGACACTGTCTGCCTGG - Intronic
1052950075 9:34201728-34201750 CAATGCCGACACTGTCTACCTGG + Intronic
1053608735 9:39687703-39687725 CAATTCTGACACTATCTACTTGG - Intergenic
1053866581 9:42444055-42444077 CAATTCTGACACTATCTACTTGG - Intergenic
1054244789 9:62654695-62654717 CAATTCTGACACTATCTACTTGG + Intergenic
1054558916 9:66689238-66689260 CAATTCTGACACTATCTACTTGG + Intergenic
1054918918 9:70522484-70522506 CAATTCTGACACTGTCTACCTGG + Intergenic
1055042756 9:71893258-71893280 CAATTCCAACATTATCTACCTGG + Intronic
1055185076 9:73441779-73441801 CAATTCTAACACTATCTTCCTGG + Intergenic
1055553090 9:77449365-77449387 CAATTCTAAGATTTTCCACTGGG - Intronic
1056086018 9:83149902-83149924 CAATTCTAACACTAACTACCAGG + Intergenic
1056342644 9:85652892-85652914 CAATTCTGACACTGAAGACCTGG - Intronic
1057006473 9:91565319-91565341 CAATTCTGACTCTATCTACCTGG + Intronic
1057011221 9:91603512-91603534 CAATTCTGCCACTAACCACCTGG + Intronic
1057021296 9:91699516-91699538 CAGTTCTGACACTGTCTACCTGG - Intronic
1057358431 9:94351271-94351293 CAATTCTGACACTATCTACCTGG - Intergenic
1057614086 9:96572397-96572419 CAATTCTGACACCATCTACCTGG - Intronic
1057649320 9:96906339-96906361 CAATTCTGACACTATCTACCTGG + Intronic
1057666645 9:97051052-97051074 TAATTCTGACACTATCTACCTGG - Intergenic
1057711435 9:97449284-97449306 TAATACTAACACTGTCTACCTGG + Intronic
1057711757 9:97451795-97451817 CAATTCTGACACTATCTACCTGG - Intronic
1059228609 9:112696546-112696568 CAATTCTGATACTATCTACCTGG + Intronic
1059472873 9:114519969-114519991 AAATTCTGACACTATCTACCTGG - Intergenic
1059826468 9:118035271-118035293 CAATTTCGACACTGTCTACCTGG + Intergenic
1059892508 9:118818535-118818557 CAATTCCAACACTATCTACCTGG + Intergenic
1060129204 9:121078565-121078587 CAATTCTGACACTGTCTACCTGG + Intronic
1060904834 9:127295499-127295521 CAATTCTCACACCGACTACCTGG + Intronic
1061128679 9:128693474-128693496 CAATTATAAAACTGTGCAGCAGG - Intronic
1061993128 9:134170902-134170924 CAGTTCCAGCAGTGTCCACCAGG + Intergenic
1185530264 X:812658-812680 AAACTCTCACACTGTCCCCCAGG - Intergenic
1186223044 X:7369957-7369979 TACTTCTCACACTGTCCACATGG + Intergenic
1186697021 X:12046420-12046442 AAATTCTGACACTATCTACCTGG + Intergenic
1186837189 X:13449887-13449909 CAATTCCAACACTATCTACCTGG + Intergenic
1187626798 X:21123679-21123701 TGATTCTGACACTATCCACCCGG + Intergenic
1187861999 X:23691818-23691840 CAATTCTGATGCTGTCCACCTGG + Intergenic
1188199389 X:27280490-27280512 CAACTCTAGCACTTACCACCAGG - Intergenic
1188968483 X:36583483-36583505 CAATTCTGACACTAACTACCTGG + Intergenic
1189464118 X:41265108-41265130 CAATTCTGACACTCTCTACCTGG - Intergenic
1189510702 X:41658406-41658428 AAATTCAAACACTATCTACCTGG - Intronic
1189516565 X:41718485-41718507 CTATTCTGACACTATCTACCTGG - Intronic
1189709487 X:43795061-43795083 CAATTCTGACAGTATCTACCTGG + Intronic
1189831698 X:44981159-44981181 CAATTCTGACATTATCTACCTGG + Intronic
1189999959 X:46676263-46676285 CAGTTCTGACACTATCTACCTGG - Intronic
1190067850 X:47254742-47254764 CAATTCTAACACTAACTACCTGG + Intergenic
1190111919 X:47595458-47595480 CAATTCTGACACTATCTACCTGG - Intronic
1190377854 X:49807614-49807636 CAATTCTGACAGTATCTACCTGG + Intergenic
1190616081 X:52233636-52233658 CAATTCTGACATTATCCACCTGG - Intergenic
1191712457 X:64164878-64164900 CAATTCCAACACTATCTACCTGG - Intergenic
1192106278 X:68320682-68320704 CAATTATGACACTATCTACCTGG + Intronic
1192202295 X:69074056-69074078 CGATTCAAACCCTGGCCACCTGG - Intergenic
1192886525 X:75341091-75341113 CAATTCTAACACTATCAATCTGG + Intergenic
1194871677 X:99140555-99140577 CAATTCTGACACTATCTATCTGG + Intergenic
1195118422 X:101723563-101723585 CAATTGTGACACTATCCACCTGG - Intergenic
1195238782 X:102929967-102929989 CAATTCTGACTCTGGGCACCAGG - Intergenic
1195383037 X:104288927-104288949 CAATTCTGACACTCTCTACCTGG - Intergenic
1196783635 X:119403885-119403907 CAGTTCTGACACTGTCTACCTGG + Intronic
1196801936 X:119551790-119551812 CAGTTCTGACACTGTCTACTCGG + Intronic
1196841372 X:119862256-119862278 CAATTCCAACATTGCCTACCTGG - Intergenic
1196884042 X:120225887-120225909 CAATTCTGACACTATCTACCTGG + Intergenic
1198256905 X:134932033-134932055 GAATTCCAACACTCTCTACCTGG + Intergenic
1199813645 X:151376442-151376464 GAATTCTTACACTCTTCACCAGG - Intergenic
1201720710 Y:17093994-17094016 CAGTTCTGACACTGTCTACATGG + Intergenic