ID: 948394168

View in Genome Browser
Species Human (GRCh38)
Location 2:237632345-237632367
Sequence CCCGCAGAGAGCTCCGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948394168 Original CRISPR CCCGCAGAGAGCTCCGGAGC AGG (reversed) Intronic
900510046 1:3054534-3054556 CCCGCCGGGAGCCCCGCAGCAGG + Intergenic
901671962 1:10861325-10861347 CTCACACAGAGCTGCGGAGCAGG + Intergenic
903295679 1:22341920-22341942 CCCAGAGAAAGCCCCGGAGCTGG - Intergenic
903885689 1:26539844-26539866 CCCCCAGCTATCTCCGGAGCTGG + Intronic
904963638 1:34354779-34354801 CCCACAGGGAGCGCTGGAGCTGG - Intergenic
906615902 1:47232489-47232511 CCCGCAGCGCGTTCCGGAGCCGG - Intergenic
906683335 1:47745975-47745997 CCTGCAGTCAGCTCCTGAGCAGG + Intergenic
908256586 1:62308498-62308520 CCAGGAGAGAGATCAGGAGCAGG - Intronic
910457415 1:87412373-87412395 CCCAAAGGGAGCTCTGGAGCTGG + Intergenic
912812601 1:112805344-112805366 CCTGCAGGGAGCTTGGGAGCTGG + Intergenic
915092042 1:153433292-153433314 CCCGCAGGGATCTACGGAGTTGG + Intergenic
915506051 1:156357135-156357157 CCGGCAGAGAGTGCCGGAGGGGG + Intronic
921062761 1:211599633-211599655 CCCACAGAGGACTCTGGAGCTGG + Intergenic
921189779 1:212699423-212699445 CCCCCAGAGGGCGCAGGAGCTGG + Intronic
923475545 1:234327929-234327951 CCCGCAGGGCCCTCAGGAGCTGG - Intergenic
1062986419 10:1773262-1773284 CCCGATAAGACCTCCGGAGCTGG + Intergenic
1063264994 10:4438269-4438291 ACTGCAGAGAGCTCCGGAATTGG + Intergenic
1063772199 10:9216300-9216322 ACCCCAGATAGCTCCAGAGCTGG - Intergenic
1065072362 10:22038974-22038996 CCCACAGGCAGCTCTGGAGCTGG - Intergenic
1065636990 10:27743466-27743488 GCCGCCGGGAGCTCCGCAGCGGG + Exonic
1065637561 10:27746050-27746072 CCCGCCGAGTCCTCCGGAGCCGG + Exonic
1065660934 10:28003773-28003795 CCCACAGAGAGCCCTGAAGCTGG + Intergenic
1067082880 10:43221538-43221560 CCAGCACAGGGCTCCGGAGAAGG + Intronic
1070747912 10:78945974-78945996 CCCACAGGGAGCTCAGGAGGGGG - Intergenic
1070822883 10:79373006-79373028 CCCTCAGAGAGCGCCAGAGGAGG + Intergenic
1071532878 10:86402337-86402359 TCAGCAGAGAGCTCAGGTGCTGG + Intergenic
1071979239 10:90986994-90987016 CCCCCAGGGAGCTGTGGAGCTGG - Intergenic
1075644870 10:124090946-124090968 TCTGCAGAGGGCTCCTGAGCTGG + Intronic
1075725675 10:124609716-124609738 CTTACAGAGAGCTCCAGAGCTGG - Intronic
1076868209 10:133179759-133179781 ACCACAGAGAGGCCCGGAGCAGG + Intronic
1080217508 11:29862075-29862097 CCCAAAGGGAGCTCTGGAGCAGG + Intergenic
1081742292 11:45449099-45449121 CCCCCAGGGAGCTCTGAAGCTGG - Intergenic
1081762312 11:45584932-45584954 CCCACAGAGAGCTATGGAGCAGG - Intergenic
1085040090 11:73321953-73321975 CCCGCACAGCGCTGTGGAGCAGG + Intronic
1085472105 11:76764987-76765009 CCCTCAGGGAGCTGTGGAGCTGG + Intergenic
1086948256 11:92865778-92865800 CTGGCAGAGAGCTGCAGAGCAGG - Intronic
1090807595 11:130212072-130212094 CCCGCAGAGAGTCCCGGAAAGGG - Intergenic
1092061826 12:5557426-5557448 CCCACAGAAAGCTCTGGAGCTGG + Intronic
1092500492 12:9041530-9041552 CCAGCAGAGTGCTGTGGAGCTGG + Intergenic
1096077657 12:48815206-48815228 TCCGCCAAGAGCTCAGGAGCTGG + Intronic
1096154938 12:49336576-49336598 CCCGCGGAGAGCCCCGGCCCCGG - Exonic
1098947644 12:76606396-76606418 TCCACAGAGAGCTCTAGAGCTGG - Intergenic
1104958465 12:132477100-132477122 CCTGCAGAGAGGCCCAGAGCTGG - Intergenic
1105602393 13:21899129-21899151 TCTGCAAAGAGCTCTGGAGCTGG - Intergenic
1106057723 13:26254304-26254326 GCCGGAGAGAGCGGCGGAGCCGG + Exonic
1111497002 13:89063858-89063880 CCCACAGGGAGATCTGGAGCTGG + Intergenic
1113848894 13:113407021-113407043 ACCGCAGAGAGCACCGCAGGAGG - Intergenic
1114595594 14:23909185-23909207 CCTGCAGAGAGTTCCGAAGATGG + Intergenic
1115959284 14:38816805-38816827 CCCACAGAGAGCTCTGGAGTAGG - Intergenic
1116937550 14:50757801-50757823 CCTGCAGAGAGCTCATGAACAGG - Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119262399 14:73245562-73245584 CCTGCAGAGAGCCCCAGAACGGG + Intronic
1121622784 14:95361716-95361738 CTCTCAGAAATCTCCGGAGCTGG + Intergenic
1122839077 14:104446011-104446033 CACGGAGGGAGCTCAGGAGCCGG - Intergenic
1126574249 15:50182236-50182258 ACCGCCGCGGGCTCCGGAGCAGG - Exonic
1129260803 15:74366100-74366122 CCCGCGAAGAGCGCAGGAGCAGG + Intronic
1129692716 15:77722923-77722945 CCAGCAGGGCGCTCCGGGGCTGG + Intronic
1130685422 15:86032816-86032838 GCCACAGAGAGCTCTGGAGCTGG - Intergenic
1132700622 16:1220632-1220654 CCCACAGAGGGCTCAGGCGCCGG + Exonic
1132906823 16:2286716-2286738 CCTGCAGGGCGCTCCGGGGCTGG + Exonic
1134658996 16:15969759-15969781 CCTGCAAAGAGCTCCTGAGAGGG - Intronic
1140078460 16:71723395-71723417 CCCTCCGAGCCCTCCGGAGCCGG + Intronic
1141184916 16:81779937-81779959 TACGCAGACAGCTGCGGAGCGGG - Intronic
1141515217 16:84539635-84539657 CCCTCAAAGAGCTCAGGATCTGG + Intronic
1143130504 17:4674284-4674306 CCCGCAGAGAGGCCAGGAGGAGG - Intronic
1145263287 17:21367226-21367248 CCGGCAGAAAGCTCTAGAGCTGG - Intergenic
1147599050 17:41734516-41734538 TGCGCAGAGGGCTCCGGAGCGGG + Exonic
1147776603 17:42906324-42906346 CCCACAGCGAGCTCTGAAGCTGG + Intronic
1147996593 17:44363220-44363242 CCCGCAGGGGGCTGCGGAGCAGG + Intronic
1148048846 17:44759476-44759498 CCCGCAGAGACCTGCAGAGCTGG - Intronic
1148104678 17:45112956-45112978 CCAGCTGCGGGCTCCGGAGCTGG - Exonic
1148119253 17:45197977-45197999 CCCGCAGAGAGGGCCCCAGCCGG - Intergenic
1150250123 17:63700321-63700343 CCCGCGGGGCGCTGCGGAGCCGG - Intronic
1151347084 17:73508746-73508768 CCCACAGACAGCTTCAGAGCTGG + Intronic
1151913430 17:77100047-77100069 CCCGCTGGGAGCGCCAGAGCAGG - Intronic
1152372821 17:79901183-79901205 CCAACAGGGAGCTCTGGAGCTGG + Intergenic
1156462375 18:37328327-37328349 CCCGCAGGGAGCTGGGGAGAGGG + Intronic
1157251235 18:46098089-46098111 CCTGCAGAGAGCGCCCGAGCCGG + Intronic
1157717220 18:49896276-49896298 CCCACAGAGTGCTGGGGAGCGGG - Intronic
1158828062 18:61246762-61246784 TCCGGAGGGAGCTCTGGAGCTGG + Intergenic
1161222259 19:3123120-3123142 CCCCCAGAGGGCTCCGCTGCTGG - Exonic
1162453184 19:10766886-10766908 CCCTCAGAGAGGTTCGCAGCTGG - Intronic
1162630817 19:11925502-11925524 CCCAGAGAGGGCTCCGGGGCAGG - Intronic
1162635686 19:11965434-11965456 CCCAGAGAGGGCTCCGGGGCGGG - Intronic
1162638418 19:11988046-11988068 CCCAGAGAGAGCTCCGGGGCAGG - Intergenic
1162659190 19:12156298-12156320 CCCAGAGAGGGCTCCGGGGCCGG + Intronic
1162711306 19:12596955-12596977 CCCGGAAAGGGCTCCGGGGCCGG + Intronic
1163851943 19:19669157-19669179 CCCTGAGAGGGCTCCGGGGCCGG - Intronic
1165148228 19:33745686-33745708 CCCACAGGGAGCTCTGGAGCTGG + Intronic
1167643801 19:50695326-50695348 ACCGCGGACAGCTCCGGAGGCGG + Intronic
925284848 2:2709253-2709275 CCCCCAGAGTGCGCCGGTGCCGG + Intergenic
927692612 2:25218999-25219021 CCTGCAGAGATCTCCAGAACAGG - Intergenic
929501373 2:42493911-42493933 GCCGCAGGGAGCGCCGGAGACGG - Exonic
929571293 2:43024666-43024688 CCAGCAGAGGTCTCCAGAGCAGG + Intergenic
932440791 2:71733440-71733462 CCCTCATAGAGCTCCTGGGCAGG - Intergenic
932464006 2:71901828-71901850 CCCACAGGGAGCTCTGAAGCTGG - Intergenic
934116930 2:88807536-88807558 ACTGCAGGGAGCTCTGGAGCTGG - Intergenic
935125313 2:100217555-100217577 CTCGCAGGAAGCTCTGGAGCCGG + Intergenic
935826940 2:106961732-106961754 TCCACAGGGAGCTCTGGAGCAGG - Intergenic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
937814601 2:126237554-126237576 CAAGGAGAGAGGTCCGGAGCAGG - Intergenic
938109647 2:128555273-128555295 CCTGCAGAGAGCTCTGAAACTGG + Intergenic
941624420 2:167815056-167815078 CCTGCAGGGAGCTCTGGGGCTGG - Intergenic
942514556 2:176738144-176738166 CCCACAAAGAGGTCTGGAGCTGG - Intergenic
943145783 2:184043187-184043209 CCCTCAGGGAACTCTGGAGCTGG - Intergenic
948394168 2:237632345-237632367 CCCGCAGAGAGCTCCGGAGCAGG - Intronic
948656525 2:239479876-239479898 CCCAGAGGGAGCTTCGGAGCTGG + Intergenic
948983732 2:241508086-241508108 CCCGCGGAGAGGCGCGGAGCCGG + Exonic
1171189731 20:23150607-23150629 CCCCCAGAGATCTCAGGGGCAGG + Intergenic
1171213065 20:23331695-23331717 CCCGCTGGGGGCTCTGGAGCAGG + Intergenic
1171336262 20:24388469-24388491 TCTGCAGAGAGCTCCTGAGCAGG + Intergenic
1173398579 20:42703802-42703824 GCCGCAGAGAGCTCGTGTGCAGG - Intronic
1173858660 20:46267980-46268002 CCCACAGGGAACTCTGGAGCTGG + Intronic
1175926271 20:62473145-62473167 CCCCCAGAGCGCTCCAGGGCTGG + Intronic
1175926611 20:62474414-62474436 CCCAAAGGCAGCTCCGGAGCTGG + Intronic
1175930462 20:62491513-62491535 GCCCCAGAGAGCTCTGGAGGAGG + Intergenic
1179317239 21:40254653-40254675 CCTGCAAAGAGCTCTGAAGCTGG - Intronic
1179495450 21:41768617-41768639 CCGGCACACAGCTCCGCAGCTGG + Intergenic
1181341276 22:22182042-22182064 CCCACAGAGGGCTCAGCAGCAGG - Intergenic
1181410332 22:22713869-22713891 CACACAGGGAGCTCTGGAGCTGG - Intergenic
1181417885 22:22773245-22773267 CACACAGGGAGCTCTGGAGCTGG - Intronic
1181423884 22:22820401-22820423 CCTACAGAGAGCTGTGGAGCTGG - Intronic
1183590160 22:38775365-38775387 CCCGCAGAGAGCTTCAAAGCTGG + Intronic
1184270776 22:43381671-43381693 TCCGCAGAGAGTGCTGGAGCTGG + Intergenic
1184437654 22:44489144-44489166 CCCACGGAGAGCTCTGGAGCCGG + Intergenic
950338937 3:12224490-12224512 CCCACAGAAAGTTCTGGAGCTGG - Intergenic
953036071 3:39211979-39212001 CCCAGAGGGAGCTCTGGAGCTGG + Intergenic
953201253 3:40780465-40780487 CCTGCAGGGATCTCCGGACCTGG - Intergenic
953749925 3:45601253-45601275 CCCGCAGGGAGCCTGGGAGCTGG + Intronic
965752015 3:171985138-171985160 CCTACAGAGAGTTCTGGAGCTGG - Intergenic
968850228 4:3073813-3073835 CGTGCAGAGAGCCCCGCAGCTGG + Intergenic
969052739 4:4384992-4385014 CCCGCAGGGAGCTACGGACAAGG - Intronic
969850030 4:9948684-9948706 CCCACAGGGAGCTCTGGAGCTGG - Intronic
972675611 4:41257221-41257243 CCCGCTGCGAGCACCGGAGACGG + Intronic
972771026 4:42196992-42197014 CCCACAGGGAGGTCTGGAGCAGG - Intergenic
978165298 4:105600122-105600144 CCCACGCAGAGCTCAGGAGCAGG - Intronic
985843382 5:2326284-2326306 CCCCGGGAGAGCTGCGGAGCTGG + Intergenic
986282789 5:6337261-6337283 CCAGCAGAGAGCACCTCAGCAGG + Intergenic
988606134 5:32679879-32679901 CCCACCAAGAGCTCTGGAGCTGG - Intergenic
989164478 5:38421245-38421267 CTTGCAGAGAGCACAGGAGCTGG - Intronic
990633061 5:57691810-57691832 CCCACAGGGAGCTCTGAAGCTGG - Intergenic
991975055 5:72177237-72177259 CCAGCTTAGAGCTCCGGAGAGGG - Intronic
992159054 5:73982976-73982998 TCCACAGTGAGCTCCTGAGCAGG - Intergenic
995353543 5:111210732-111210754 CTCACAGAGAGCTCTGGAGATGG + Intergenic
997422390 5:133779756-133779778 CCAGCAGAGAGCTGGGGAGGTGG - Intergenic
1002805162 6:566920-566942 CTCGCAGTGGGCTCCTGAGCAGG - Intronic
1004237843 6:13890390-13890412 TCTTCAGGGAGCTCCGGAGCTGG - Intergenic
1006098658 6:31672006-31672028 CCGGCAGAGAGCTCTGGAGTTGG - Exonic
1006937570 6:37729033-37729055 TCCTCAGGGAGCTCTGGAGCAGG + Intergenic
1007085645 6:39142837-39142859 CCCGCAGACAGATCCACAGCCGG + Intergenic
1007313626 6:40966412-40966434 TCCGCAGAGAGGTGCTGAGCTGG - Intergenic
1007402879 6:41614454-41614476 AACCCAGAGAGCTCCGGACCGGG - Intergenic
1011768318 6:90648598-90648620 CCTGCAGAGAGCTTCAGAGAAGG - Intergenic
1013099654 6:106975442-106975464 CGCGCAGATCGCTCCGGACCCGG - Intronic
1014787739 6:125637721-125637743 CCTGCAGAGAGCTGTGGAGATGG - Intergenic
1017111543 6:150937341-150937363 CCCGCAGAGCTCTCTGGAGACGG + Intronic
1017515071 6:155149116-155149138 CCCACAGCGAGCTGTGGAGCTGG + Intronic
1019279578 7:193060-193082 CCCGGGGACAGCCCCGGAGCTGG + Exonic
1019798854 7:3072907-3072929 CCCCAACAGAGCTCCAGAGCTGG - Intergenic
1019903181 7:4040546-4040568 CCTGCAGAGGGGTCCGGAGTGGG + Intronic
1020257676 7:6510968-6510990 CCCGCAGGGAGCTCCGCGGCTGG + Exonic
1020260596 7:6528765-6528787 CCCGCAGTGAGCTCCGCTCCAGG + Intronic
1023028647 7:36074361-36074383 CCCACAGGAAGCTCCAGAGCAGG + Intergenic
1024671683 7:51601290-51601312 CCCCCAGAGAGCTCTGGAAGTGG - Intergenic
1025144472 7:56492404-56492426 ACCCCAGACAGCTCCTGAGCTGG - Intergenic
1029458210 7:100681616-100681638 CCCGCAGAGAGCACAGGAAGAGG - Exonic
1033303742 7:140209270-140209292 CCCACAGGGAGCTCTGGAGCTGG + Intergenic
1035587436 8:786647-786669 CCTGCAGAGACCTCCGGGGAGGG + Intergenic
1039060012 8:33565817-33565839 CTCGCAGAGAGCTCCGCGCCCGG - Intronic
1040005743 8:42619254-42619276 CCACCAGGGAGCTCCTGAGCTGG - Intergenic
1041026612 8:53693214-53693236 CCAGCAGAGAGCACCGCAGGGGG + Intergenic
1041251566 8:55939660-55939682 CACGCCGCGAGCTCCGGGGCAGG - Intronic
1041699081 8:60767669-60767691 CCCGCACAGAGCTGCTGGGCAGG - Intronic
1047442341 8:124889196-124889218 CCCACAGGGATCTCTGGAGCTGG + Intergenic
1048477524 8:134756755-134756777 CCTGCAGGGAGCTCTGGAGCAGG - Intergenic
1049158026 8:141078740-141078762 CCCTCTGACAGCCCCGGAGCTGG + Intergenic
1049340729 8:142111202-142111224 CCCGCAGACAGATGGGGAGCAGG + Intergenic
1049378959 8:142302564-142302586 CCCGCAGAGGGCTGGGGAGACGG - Intronic
1049896156 9:113591-113613 CCCGCAGGGAGCCCCGGGGAGGG + Intergenic
1050761588 9:9078751-9078773 CCTGCAGTGAGCTCTGGAGCTGG + Intronic
1052833695 9:33235086-33235108 ACAGGAGAGAGCTCCGGACCAGG - Intronic
1053311994 9:37026219-37026241 CCCGTAGAGGGCTCCGGGCCAGG - Intronic
1058186186 9:101858188-101858210 CCAGCAGAGTGCTCCTTAGCTGG - Intergenic
1059466068 9:114469614-114469636 CCCACAGGGAGCTCTGGAGCTGG - Intronic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1061444025 9:130627459-130627481 CCAGCAGAGACCTCCAGAGCTGG + Intronic
1061877839 9:133553834-133553856 CCCACAGGGAGCCCTGGAGCGGG + Intronic
1061937161 9:133864205-133864227 CCCGCAGACAGCCGCGGGGCAGG + Intronic
1062423225 9:136494033-136494055 CCCTCAGGGAGCTCTGCAGCAGG - Intergenic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1189235641 X:39484882-39484904 CCCGCAGAAAGCTGGGGTGCTGG + Intergenic
1189357915 X:40325457-40325479 CCAGTGGAGAGCTCTGGAGCAGG - Intergenic
1189972071 X:46428066-46428088 TCTACAGAGAGCTCTGGAGCTGG - Intergenic
1190236089 X:48616835-48616857 CCAGCGGGGAGCTCTGGAGCAGG + Intergenic
1190826434 X:54022270-54022292 TCGTCAGAGAGCTCCGGAGTAGG - Exonic
1192261505 X:69508543-69508565 CCGGAAGAGAGCTATGGAGCTGG - Intronic
1195095765 X:101499702-101499724 CCTGCAGAGAGCTATGGAGATGG + Intronic
1200162209 X:154015366-154015388 CCCGCTGAGAACCCAGGAGCCGG - Intronic
1201895917 Y:18992891-18992913 CGCGCAGATCGCTCCGGACCGGG - Intergenic