ID: 948395669

View in Genome Browser
Species Human (GRCh38)
Location 2:237643260-237643282
Sequence CATTTCTAGCAAATTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948395669_948395680 23 Left 948395669 2:237643260-237643282 CCACCCAGAATTTGCTAGAAATG 0: 1
1: 1
2: 3
3: 18
4: 203
Right 948395680 2:237643306-237643328 CTACTGACTCAGAACCTCTGGGG 0: 1
1: 12
2: 169
3: 574
4: 1263
948395669_948395682 27 Left 948395669 2:237643260-237643282 CCACCCAGAATTTGCTAGAAATG 0: 1
1: 1
2: 3
3: 18
4: 203
Right 948395682 2:237643310-237643332 TGACTCAGAACCTCTGGGGGTGG 0: 1
1: 4
2: 94
3: 530
4: 1457
948395669_948395678 21 Left 948395669 2:237643260-237643282 CCACCCAGAATTTGCTAGAAATG 0: 1
1: 1
2: 3
3: 18
4: 203
Right 948395678 2:237643304-237643326 TGCTACTGACTCAGAACCTCTGG 0: 1
1: 0
2: 8
3: 59
4: 538
948395669_948395679 22 Left 948395669 2:237643260-237643282 CCACCCAGAATTTGCTAGAAATG 0: 1
1: 1
2: 3
3: 18
4: 203
Right 948395679 2:237643305-237643327 GCTACTGACTCAGAACCTCTGGG 0: 1
1: 3
2: 25
3: 293
4: 1003
948395669_948395681 24 Left 948395669 2:237643260-237643282 CCACCCAGAATTTGCTAGAAATG 0: 1
1: 1
2: 3
3: 18
4: 203
Right 948395681 2:237643307-237643329 TACTGACTCAGAACCTCTGGGGG 0: 1
1: 3
2: 104
3: 386
4: 876

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948395669 Original CRISPR CATTTCTAGCAAATTCTGGG TGG (reversed) Intronic
900734713 1:4291303-4291325 CATTTCTGAAAGATTCTGGGGGG + Intergenic
901912848 1:12474543-12474565 CATTTCTAGCTAAGTCTGATGGG + Intronic
910214953 1:84833967-84833989 CTTTTCTAACTAATTCTGGAGGG + Intronic
910349974 1:86285228-86285250 CATATCTAGAAAATTCAAGGAGG + Intergenic
910756187 1:90694219-90694241 CATTTTTAGAAGGTTCTGGGTGG - Intergenic
912591548 1:110825562-110825584 CATTTCTAGGAATTTTTAGGTGG - Intergenic
913443019 1:118919259-118919281 AATTTCTTGCTAATTCTGTGAGG + Intronic
916254706 1:162774898-162774920 GATTCCTAGCAAACTCTTGGAGG + Intronic
917450375 1:175142922-175142944 CATTTCTAACAAGTTCTCAGGGG + Intronic
920958730 1:210645059-210645081 CCTTTCTAGAAAATTTTGTGAGG - Intronic
921188896 1:212692777-212692799 CATTTCTTGCATATCCTGAGGGG - Intronic
923719566 1:236455350-236455372 CATCTCCAGCAAATGCTGGTCGG - Intronic
1062783709 10:241698-241720 CATTTCTAACAAATTCCCAGGGG + Intronic
1064355431 10:14613629-14613651 CATCTCTATCAAATTCTGCCTGG + Intronic
1064572071 10:16704003-16704025 CATTTCTAACAAGTTCTTAGTGG + Intronic
1067274742 10:44823642-44823664 CATTGAAAGCAACTTCTGGGTGG + Intergenic
1068501168 10:57841140-57841162 CTTTTCTTGTAAATGCTGGGTGG - Intergenic
1073899836 10:108206913-108206935 CATTTATAGCAATTTATGGTGGG - Intergenic
1076073845 10:127516096-127516118 CATTTCTAGAAATTCTTGGGGGG - Intergenic
1076280384 10:129241886-129241908 CATTTCCATTAAATTCTGAGTGG + Intergenic
1076283142 10:129267419-129267441 AATGTATAGGAAATTCTGGGGGG + Intergenic
1076900883 10:133336797-133336819 CATTTCTTGCAGAATGTGGGCGG - Intronic
1078454149 11:11462139-11462161 CATTTCTAGCAAGTTATGAGAGG + Intronic
1078883938 11:15481092-15481114 CATTAGTAGCAAATGCTTGGAGG - Intergenic
1079046487 11:17108492-17108514 CATATCAAGCTAATTTTGGGAGG + Intronic
1081358863 11:42147078-42147100 CATTTTTTGAAAATTTTGGGGGG + Intergenic
1084903226 11:72325824-72325846 CATTTTTGGAAAACTCTGGGTGG + Intronic
1087017176 11:93565204-93565226 AAATTCTAGCTAATTCTGGTTGG + Intergenic
1089690412 11:120183639-120183661 CATCTCTATCAAATTCTAGTGGG - Intronic
1090413435 11:126524674-126524696 CATTTCTGGGAGATTCGGGGGGG + Intronic
1090684604 11:129101111-129101133 CATTTCTGGAAATTTTTGGGGGG - Intronic
1092680428 12:10973860-10973882 AATCTCTATCAAATTCTGGCGGG + Intronic
1093657999 12:21719641-21719663 CAATACTAGCATATTCTTGGTGG + Intronic
1093833005 12:23788824-23788846 CATTTCTAGTGAATGCTGTGTGG - Intronic
1094495854 12:30988928-30988950 AATTTCTAGAATATTCTGGCTGG + Intronic
1095071309 12:37852178-37852200 AATTTCTTGCAAATTCTGAGTGG + Intergenic
1097801170 12:63916192-63916214 CATTTCTAGAAAAATCAGGCAGG - Intronic
1099714896 12:86278580-86278602 CAGTTCTAGTAATTTCTTGGTGG + Intronic
1101320767 12:103671043-103671065 CATTTCTAACAAGTTCCGAGGGG + Intronic
1101551847 12:105770699-105770721 TAATTGTAGCAAATTTTGGGTGG + Intergenic
1103656084 12:122471672-122471694 TATTTCTAGCACATTCTGTGAGG + Intergenic
1105967659 13:25399291-25399313 CATTTCTCACAAATTCTCAGGGG + Intronic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1107389228 13:39945734-39945756 CATTTCTGGAAAATTTTAGGGGG - Intergenic
1108820903 13:54348276-54348298 CATATCTTGATAATTCTGGGAGG + Intergenic
1109004345 13:56852351-56852373 CATTTAAATCAAATTTTGGGAGG - Intergenic
1112151431 13:96768973-96768995 CAGCTCTAACAAACTCTGGGAGG + Intronic
1113553108 13:111208627-111208649 CATTTCCAGCAAATTCTACAGGG - Intronic
1114355905 14:21907847-21907869 AATTTCTAGCAAGTTCTGCTGGG + Intergenic
1117283139 14:54260092-54260114 CATTTCTTCCAACTTCTGTGAGG + Intergenic
1117356253 14:54926362-54926384 CATTTCTAACAAGTTCTCAGGGG - Intergenic
1117579158 14:57134457-57134479 CATTTCTAATAAATAATGGGAGG - Intergenic
1118674789 14:68172114-68172136 CCTTTCTAGTAAATTCTGTTAGG + Intronic
1119757009 14:77126346-77126368 CCTTTGTTTCAAATTCTGGGAGG - Intronic
1121579785 14:95020631-95020653 CATTTTTATCAAACTCTGAGAGG - Intergenic
1121831655 14:97057372-97057394 CATTTCTAGAAAAAACTGTGGGG - Intergenic
1122568964 14:102680975-102680997 CATTTTTAGTAAAATCTGAGAGG - Intronic
1123210589 14:106756562-106756584 GATTTCTAGCAAAGTGTGGATGG + Intergenic
1125317167 15:38443197-38443219 TATTTATATAAAATTCTGGGGGG - Intergenic
1126227560 15:46289390-46289412 CATTTCTAGAAGATTTTAGGGGG + Intergenic
1127594026 15:60460043-60460065 CATTTCTACAAAAATCTAGGTGG - Intronic
1128317994 15:66673230-66673252 CATTTCTAACAAGTTCTCAGGGG + Intronic
1128852618 15:70975317-70975339 CTTATATAGAAAATTCTGGGAGG + Intronic
1129511619 15:76127871-76127893 CATTTCTAACAAATTCCCAGAGG - Intronic
1130379538 15:83359759-83359781 CATTTCAAGGAAATTCTGTTAGG + Intergenic
1130526725 15:84713528-84713550 CATTCCTAACAACCTCTGGGAGG + Intronic
1131332174 15:91511376-91511398 CATTTCTAACAAGCTCTGAGTGG + Intergenic
1131587903 15:93716014-93716036 CCTTTCTCGCCATTTCTGGGAGG - Intergenic
1132102659 15:99035955-99035977 CATTTCTAGTAATTTTTAGGTGG - Intergenic
1132525424 16:411798-411820 CATTTCTGGCAGGTGCTGGGTGG + Intronic
1138091490 16:54178248-54178270 CATTTCTAGGCAGTTTTGGGAGG + Intergenic
1138776578 16:59730214-59730236 CATTTCTGGTAGATTTTGGGGGG - Intronic
1138913867 16:61438674-61438696 CAATTCTAGGGAATTCTTGGAGG - Intergenic
1139129838 16:64129530-64129552 TATTTCTATCAAGTTCTGAGTGG + Intergenic
1140630384 16:76845462-76845484 CATTTCTAGAGAATCCTGGCAGG + Intergenic
1140977417 16:80073325-80073347 CATTGCTAGGAAATTTGGGGAGG - Intergenic
1141266971 16:82506519-82506541 CATTTCTTACAAATTCTGTTTGG + Intergenic
1141648539 16:85380055-85380077 CATTTCTAGAACATTCTGATGGG + Intergenic
1144387510 17:14763173-14763195 CATTTGCAGCAAGTTCTGGCTGG + Intergenic
1148510300 17:48163166-48163188 CATTACAACTAAATTCTGGGTGG + Intronic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1149233251 17:54560900-54560922 CATTTCTTGCATATTCTCTGAGG - Intergenic
1150628304 17:66858095-66858117 CCTCTCTAGCAGCTTCTGGGAGG + Intronic
1154007822 18:10548042-10548064 CATTTCTAACAAATTCCAGGGGG - Intronic
1154039765 18:10842902-10842924 CTTTTGTAGCAAATTCTGTAGGG + Intronic
1157630611 18:49091659-49091681 CATTTCTAGCAAGTTCCTAGGGG + Intronic
1158557587 18:58488019-58488041 CATTTCTACCAGGCTCTGGGGGG + Intronic
1164603445 19:29578977-29578999 CATTTCTAGCAAACTCTCGGAGG + Intergenic
1165205080 19:34176955-34176977 CAATTCTAGCCAATCCTGGTGGG + Intronic
1166313997 19:41978500-41978522 CATTTACAGTATATTCTGGGAGG + Intronic
925167899 2:1729874-1729896 CATTTCAAACAAATACTGTGTGG + Intronic
926056348 2:9776256-9776278 CATCTCTAGCCAAGGCTGGGGGG - Intergenic
927403627 2:22742871-22742893 CATTTCTAACAACTTCTCAGGGG + Intergenic
928982308 2:37148782-37148804 AATTACATGCAAATTCTGGGGGG - Intronic
930534397 2:52629190-52629212 CTTTTTTAGCAAAATCTTGGTGG + Intergenic
930900499 2:56501163-56501185 CATTTATTGCAAATTGTGGCTGG + Intergenic
931361552 2:61582225-61582247 CATTTCTAACAAGTTCCGGGTGG - Intergenic
932837594 2:75051673-75051695 CATTTCTAACAAGCTCTGAGGGG - Intronic
933225529 2:79744484-79744506 CTTTTCCAGGAAATTCTGAGTGG - Exonic
933619198 2:84517556-84517578 CATTTCTTGCAAGTTCTTGGCGG - Intronic
934085557 2:88506269-88506291 CACTTCTAGCAAATTCCCAGGGG - Intergenic
934932827 2:98442190-98442212 CATTTCTAGCAAGTTCTGGGAGG + Intergenic
935995877 2:108772443-108772465 AATTTCTAGTTAATTTTGGGGGG - Intronic
937666418 2:124492848-124492870 TAGTTCTAGCAAATTTTTGGTGG + Intronic
937961082 2:127459440-127459462 CATTTCTAACTCATTCTGTGAGG + Intronic
938994751 2:136666334-136666356 CAGTTGCAGCAAATTCAGGGAGG - Intergenic
939218058 2:139265571-139265593 ATTTTGTAGCACATTCTGGGTGG + Intergenic
939715586 2:145579662-145579684 CATCTCTAGCAATTTGTGGAGGG - Intergenic
939959649 2:148555054-148555076 CATTTCTAACAAGTTCTCAGTGG + Intergenic
939966623 2:148616634-148616656 CATTCCTAGCTAATACAGGGAGG - Intergenic
941243800 2:163072309-163072331 CTTTTCTTGTAAATGCTGGGCGG - Intergenic
942303783 2:174586777-174586799 CATTTCTAACAGCTTCTGGGTGG - Intronic
944102315 2:196040830-196040852 CAGTTCTAACAATTTTTGGGTGG - Intronic
945423126 2:209663547-209663569 CAATTTTTGCAAATGCTGGGTGG + Intronic
947007789 2:225532141-225532163 CATTTCTATCATATTCTTAGAGG + Intronic
948395669 2:237643260-237643282 CATTTCTAGCAAATTCTGGGTGG - Intronic
1170010616 20:11718726-11718748 CATTTCTAGCACTTTCAGGGAGG - Intergenic
1170825358 20:19790003-19790025 CATTTCTAGCTACTTCTTGACGG + Intergenic
1178684938 21:34703312-34703334 TCTTTCTAGAAAATTCTGTGTGG - Intronic
1179556117 21:42177576-42177598 GATTTCTAGCACATTCTCGGTGG - Intergenic
1182249768 22:28990884-28990906 CGTTTCTAGCAAAGCCTGGTTGG + Intronic
1184884463 22:47333924-47333946 CATTTCTACCACATTCTGTTTGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949232450 3:1767138-1767160 CGTTTCAAGCATAGTCTGGGTGG + Intergenic
949260720 3:2099698-2099720 CGTTTCCAGCAACTTCTGGGGGG + Intronic
950405497 3:12801773-12801795 CATTTCTAACAAATTCCTGGAGG - Intronic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951043096 3:18009882-18009904 CATTTCTAGGCAATTCTGTTTGG + Intronic
951130508 3:19037321-19037343 CATTTCTAACTAATTGTGGCTGG + Intergenic
952251179 3:31656243-31656265 CATTTCAAGAAATTACTGGGCGG - Intergenic
952345923 3:32485468-32485490 CATTACTATAAAATTCTGTGGGG - Intronic
956814126 3:72892528-72892550 CCTTTCCCTCAAATTCTGGGAGG - Intronic
957216008 3:77320256-77320278 GATTTCTAGCAATTGCTGGCTGG + Intronic
957232047 3:77532224-77532246 CATTTTTACCAAGTTCTGAGAGG - Intronic
961135316 3:124504700-124504722 CCTCTCAAGCAAATTCTGGTTGG + Intronic
961932995 3:130553943-130553965 CATTTCTGGAAGATTCTAGGGGG + Intergenic
962547812 3:136455262-136455284 GAGTTCTAGCATATTCAGGGTGG - Intronic
963874064 3:150453595-150453617 CATTTCTAACAAGGTCTTGGTGG + Intronic
964282531 3:155081778-155081800 CATTTCCAGTTAATTCTGGAAGG - Intronic
964316920 3:155455011-155455033 CCTTTCTTGCAAATTCAAGGTGG - Intronic
966436436 3:179889606-179889628 GATTCCTAGCAAAATCTGCGAGG - Intronic
967305873 3:188058897-188058919 CATTTCTGGCATATTCTGGGGGG + Intergenic
967659636 3:192090949-192090971 CATTTTTAGAAGATTATGGGGGG - Intergenic
968195089 3:196699887-196699909 CAGTTCTAGCAACTTGTGGCAGG - Intronic
968217079 3:196901920-196901942 CATTTCTAGTAAGTTCTCAGGGG - Intronic
970309676 4:14768855-14768877 CATTTGTAGCAGATGCTGCGGGG - Intergenic
972129067 4:35807598-35807620 AATTTATAGAAAATGCTGGGAGG + Intergenic
973535209 4:51874439-51874461 CATTTCTACCTAATTCAGTGTGG + Intronic
973570281 4:52231882-52231904 CACTTCCAGCAAATTATGTGAGG - Intergenic
975810684 4:78165896-78165918 CATTTCTACCACATTCTGTTTGG + Intronic
976218033 4:82732905-82732927 CATTTCTAGCAAGTTCCAGGTGG - Intronic
981080495 4:140635050-140635072 CATTTATAGTTAACTCTGGGTGG + Intronic
982328888 4:154159215-154159237 GATCTGAAGCAAATTCTGGGAGG + Intergenic
986543166 5:8868644-8868666 CATTTCTATTAAATTGTGAGGGG + Intergenic
988200955 5:28067360-28067382 CATTTCTAGAAGATTTTAGGGGG - Intergenic
990196667 5:53324504-53324526 CATTGCTACTAAATTCTTGGTGG + Intergenic
991567719 5:68021793-68021815 CATTTCTAACAAGTTCGTGGGGG - Intergenic
992033496 5:72747980-72748002 CAGTTCTTGAATATTCTGGGGGG - Intergenic
992237973 5:74731538-74731560 CACTTAGAGCAAAGTCTGGGAGG - Intronic
992459883 5:76951106-76951128 CATTCCCACCAAATTCTAGGTGG - Intergenic
992471313 5:77057887-77057909 CATTCCCAGCACATTCTGGTTGG + Intronic
994317807 5:98353852-98353874 CAGTTCTAACAATTTCTTGGTGG - Intergenic
994402092 5:99293963-99293985 CATCTCAAGCAAATTCTGTTTGG + Intergenic
994679559 5:102868652-102868674 CAGTTCAAGCAAATACAGGGGGG - Intronic
995341523 5:111066224-111066246 GATTTCTTGCAAATCCTGGTTGG + Intergenic
995842434 5:116455715-116455737 CATTTCTAGAAAATTCAAGTTGG - Intronic
998964544 5:147525001-147525023 GATTTGTAGGAAATCCTGGGAGG + Intergenic
999806397 5:155085441-155085463 CATTTCTAGCAGCTTCTGGGTGG - Intergenic
999832130 5:155330755-155330777 CATTTTTCTCACATTCTGGGGGG + Intergenic
1000585511 5:163093089-163093111 ACTTTTTAGCAAATTCTGAGAGG + Intergenic
1000615398 5:163420266-163420288 CATTTCTAGAAATTTCTGATTGG + Intergenic
1000700800 5:164446951-164446973 AATTCCTAGCAGATCCTGGGAGG - Intergenic
1001042231 5:168344791-168344813 CATTTATAGTAAATATTGGGGGG + Intronic
1002459685 5:179367176-179367198 CAGTTCTAGCATCTTCTGAGTGG + Intergenic
1004205976 6:13592173-13592195 CATTTTTAACAAGTTCTTGGGGG - Intronic
1007022874 6:38539926-38539948 TATTTCTAGCAACTTTTAGGTGG + Intronic
1007290776 6:40784810-40784832 CATTTCTGCCAGGTTCTGGGTGG - Intergenic
1007821665 6:44564964-44564986 CATTTCTAGCACACTGTGGGTGG + Intergenic
1011396302 6:86912502-86912524 CACTTTTAGCAAAATCTGTGAGG + Intergenic
1015316334 6:131821121-131821143 CATTTCTTACAAATTCTAAGAGG - Intronic
1016192499 6:141288449-141288471 CCTATCTAGGAAATTCTGGATGG - Intergenic
1016264603 6:142216835-142216857 CATGTCCAGTAAATTCTGGATGG + Intronic
1017063986 6:150511604-150511626 CATTTCTAACAAACTGTGGGAGG - Intergenic
1017649738 6:156570023-156570045 CATTTCTAACAAGTTGTAGGGGG + Intergenic
1019073652 6:169369939-169369961 AATTTCTGGCAAATTCTATGGGG - Intergenic
1019563464 7:1668888-1668910 GATTTCATGCAAATACTGGGGGG - Intergenic
1022666143 7:32412865-32412887 CATTTATAGGAAATTCTAGAAGG + Intergenic
1023364016 7:39445242-39445264 CATTTCTATCTCATTCTGGGTGG - Intronic
1024184802 7:46939252-46939274 TATTTCTAGCAGAATCTGAGAGG - Intergenic
1026328074 7:69328116-69328138 AATATCTAGAGAATTCTGGGAGG + Intergenic
1026566226 7:71491761-71491783 CATTTCTAGCAAGTACCAGGTGG + Intronic
1032356783 7:131218502-131218524 CATTCCAAGCTAATTATGGGAGG - Intronic
1034836532 7:154357598-154357620 CATTTCTAAAGAATTGTGGGAGG + Intronic
1035584766 8:763521-763543 CCTTTCGAGCAAATTCTATGAGG - Intergenic
1035662556 8:1359073-1359095 CATTTCTAGCAAATTCCCAGGGG + Intergenic
1037373466 8:18204923-18204945 CATTTCTAGAAGATTCTAGTGGG + Intronic
1037385162 8:18332245-18332267 GAATTCTAGTAAATTCAGGGTGG - Intergenic
1038679154 8:29651003-29651025 CCTTTCTTGAAATTTCTGGGGGG + Intergenic
1040463217 8:47670028-47670050 CATTTAAAGCAAAGTCTTGGGGG + Intronic
1041992520 8:64011568-64011590 CATTTATATCATTTTCTGGGTGG + Intergenic
1042628530 8:70789276-70789298 CATTTCTAACATATTCTTCGTGG - Intronic
1043074462 8:75679198-75679220 CATTCTTAGCAAATTTTGTGGGG + Intergenic
1044127438 8:88475086-88475108 CATTTCTGGGAAATTTTAGGGGG - Intergenic
1045036804 8:98182199-98182221 GGTTTCTGGCAAATGCTGGGTGG + Intergenic
1045427583 8:102082430-102082452 CATTTGTATCAATTTCTGGCAGG - Intronic
1046321694 8:112585810-112585832 ATTTTCAAGCAAATTATGGGGGG - Intronic
1046456544 8:114471920-114471942 CATCTAAAGCAAATTTTGGGTGG - Intergenic
1046529971 8:115431836-115431858 AATTTTGAGCAAATTTTGGGTGG + Intronic
1048491135 8:134895088-134895110 GATTTCTGGCAAGTTCTGGAGGG - Intergenic
1048664968 8:136650769-136650791 GATTTCAAGCAAATTCTAGAGGG - Intergenic
1049149125 8:141023071-141023093 CTTGTCCAGCACATTCTGGGCGG - Intergenic
1050005848 9:1129420-1129442 CATTTCTAACAAGTTCTTCGGGG + Intergenic
1051993323 9:23180825-23180847 CATTCCTAGCCAAGTCTAGGAGG + Intergenic
1053162585 9:35823958-35823980 ATTTTCTTGCAAATTCTGGCTGG - Intronic
1053534254 9:38910462-38910484 CACATCTGGCAAAGTCTGGGAGG + Intergenic
1054853580 9:69874036-69874058 CACGTGTAGCAAATTGTGGGTGG + Intronic
1055776410 9:79770994-79771016 CATTTCTACCCAATTCTTGGAGG + Intergenic
1056120414 9:83482493-83482515 CATTACTAGTAAATTCTGCTAGG + Intronic
1056687340 9:88777538-88777560 CTTTTCTTGGAAATTTTGGGGGG + Intergenic
1060053780 9:120395836-120395858 CATTTCTGGCAAATTAGGTGTGG + Intronic
1186980277 X:14951153-14951175 CATTTCTAGCAAGTTCTCAGGGG + Intergenic
1187003767 X:15210138-15210160 CATTTTTATCAAATCCGGGGAGG - Intergenic
1187607714 X:20905014-20905036 CATTTCTAGGAGATTTTAGGGGG + Intergenic
1188571100 X:31585784-31585806 CATTTCTATCAAATTCCCAGGGG - Intronic
1197790552 X:130249564-130249586 CATTTCTAGAAGATTTTAGGGGG - Intronic
1198627025 X:138587841-138587863 CATTTCTAGAAAATTTTAAGGGG + Intergenic