ID: 948397011

View in Genome Browser
Species Human (GRCh38)
Location 2:237652310-237652332
Sequence GTCAATGATGTGAACACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 407}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948397011 Original CRISPR GTCAATGATGTGAACACGGC TGG Intronic
900214322 1:1473227-1473249 GAGAATGGTGTGAACACGGGAGG - Intronic
900248333 1:1650453-1650475 GAGAATGGTGTGAACACGGGAGG - Intronic
902197189 1:14806347-14806369 GTCAAAAAAATGAACACGGCAGG - Intronic
903048552 1:20583710-20583732 GAGAATGGTGTGAACACGGGAGG + Intergenic
904111596 1:28130453-28130475 ATCAATCATGTGACAACGGCAGG + Intergenic
904121658 1:28202367-28202389 GAGAATGATGTGAACCCGGGAGG - Intronic
905112126 1:35603321-35603343 GTCAATGATTCGAACACTGAAGG + Exonic
905136666 1:35805787-35805809 GAAAATGATGTGAACCCGGGAGG + Intergenic
905551454 1:38843628-38843650 GAGAATGATGTGAACCCGGGAGG + Intronic
906162590 1:43661514-43661536 GAGAATGGTGTGAACCCGGCGGG + Intronic
906493618 1:46287196-46287218 GTGAATGGTGTGAACCCGGGCGG - Intronic
907397045 1:54198420-54198442 GAGAATGATGTGAACCCGGGAGG - Intronic
907960520 1:59276126-59276148 GAGAATGGTGTGAACACGGGAGG - Intergenic
909810373 1:79925032-79925054 GAGAATGGTGTGAACACGGGAGG + Intergenic
910871335 1:91835736-91835758 GACAATGACGTGAACCCGGAAGG + Intronic
911057231 1:93719428-93719450 GAGAATGATGTGAACCCGGGAGG - Intronic
911659338 1:100482894-100482916 GTCATTTATGGGAACACGGATGG - Intronic
911981815 1:104578572-104578594 GTCAAAGCTGTGAAGATGGCTGG - Intergenic
913464975 1:119131550-119131572 GAGAATGATGTGAACCCGGGAGG - Intronic
914418174 1:147504069-147504091 GAGAATGGTGTGAACCCGGCGGG - Intergenic
914910368 1:151780758-151780780 GAGAATGATGTGAACATGGGAGG + Intronic
916552048 1:165858841-165858863 GTCACTGCTTTGAACACAGCTGG - Intronic
916700956 1:167294257-167294279 GAGAATGATGTGAACCCGGGAGG + Intronic
917375377 1:174347580-174347602 GAGAATGGTGTGAACCCGGCAGG - Intronic
917414900 1:174798315-174798337 GAGAATGATGTGAACCCGGGAGG + Intronic
919153829 1:193735333-193735355 GAGAATGATGTGAACCCGGGAGG - Intergenic
919855177 1:201700919-201700941 GAGAATGATGTGAACCCGGGAGG + Intronic
920125632 1:203691969-203691991 GAGAATGGTGTGAACACGGGAGG - Intronic
920173496 1:204085888-204085910 GTGAATGGTGTGAACCCGGGAGG + Intronic
920780657 1:208988080-208988102 GAGAATGATGTGAACCCGGGAGG - Intergenic
921026120 1:211284141-211284163 GAGAATGGCGTGAACACGGCAGG - Intronic
921251166 1:213299892-213299914 GAGAATGGTGTGAACACGGGAGG - Intergenic
921318660 1:213916377-213916399 GAGAATGATGTGAACCCGGGAGG + Intergenic
921927956 1:220728368-220728390 GAGAATGGTGTGAACCCGGCAGG + Intergenic
922301589 1:224306354-224306376 GAGAATGACGTGAACCCGGCAGG - Intronic
923451086 1:234117794-234117816 GAGAATGGTGTGAACCCGGCAGG + Intronic
924166099 1:241284958-241284980 GAGAATGATGTGAACCCGGGAGG - Intronic
924184953 1:241478317-241478339 GAGAATGATGTGAACCCGGGAGG + Intergenic
1062852739 10:758042-758064 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1063413049 10:5851537-5851559 GAGAATGATGTGAACCCGGGAGG - Intergenic
1064023304 10:11826665-11826687 GAGAATGGTGTGAACACGGGAGG - Intronic
1064382874 10:14862114-14862136 GAGAATGGCGTGAACACGGCAGG - Intronic
1065420087 10:25533666-25533688 TTCAATGAAGTGAACAAGGCAGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1066472854 10:35716260-35716282 GAGAATGACGTGAACACGGGAGG + Intergenic
1067202129 10:44182133-44182155 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1068322584 10:55438986-55439008 GAGAATGATGTGAACCCGGGAGG - Intronic
1068449126 10:57164054-57164076 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1074476392 10:113778731-113778753 GAGAATGGTGTGAACCCGGCAGG - Intronic
1074916369 10:117959894-117959916 GTTAATGAGGTGAAAAGGGCAGG + Intergenic
1075151876 10:119940275-119940297 GAGAATGGTGTGAACACGGGAGG - Intronic
1076415458 10:130284081-130284103 GAGAATGATGTGAACCCGGGAGG + Intergenic
1077609988 11:3638189-3638211 GAGAATGATGTGAACCCGGGAGG - Intergenic
1078138018 11:8668673-8668695 GACAATGGTGTGAACCCGGGAGG - Intronic
1081507983 11:43737981-43738003 GAGAATGATGTGAACCCGGCAGG + Intronic
1082035030 11:47638454-47638476 GAGAATGACGTGAACCCGGCAGG + Intronic
1082192883 11:49268442-49268464 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1084288688 11:68147926-68147948 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1084884433 11:72194487-72194509 GAGAATGGTGTGAACCCGGCAGG - Intronic
1085460479 11:76690177-76690199 GGGACTGATGTGAACAGGGCAGG - Intergenic
1088346682 11:108834836-108834858 GAGAATGATGTGAACCCGGGAGG + Intronic
1088362765 11:109008342-109008364 GTGAATGATGTGAACCCGGGAGG + Intergenic
1090134785 11:124185988-124186010 GGCAATGAGGTGAGCACTGCAGG - Exonic
1090717755 11:129445176-129445198 GGCAAGCATGGGAACACGGCCGG - Intronic
1091861111 12:3784884-3784906 GAGAATGGTGTGAACACGGGAGG - Intergenic
1092442393 12:8517854-8517876 GAGAATGATGTGAACCCGGGAGG + Intronic
1092457364 12:8656148-8656170 GAGAATGATGTGAACCCGGGAGG - Intronic
1094030671 12:26008181-26008203 GAGAATGATGTGAACCCGGGAGG + Intronic
1094486403 12:30928808-30928830 AACAATGATGTGATCATGGCTGG - Intronic
1095213432 12:39521214-39521236 GAGAATGATGTGAACCCGGGAGG - Intergenic
1095223830 12:39654496-39654518 GAGAATGGTGTGAACCCGGCAGG + Intronic
1095943850 12:47742618-47742640 GTCAGTGCTGAGAACATGGCGGG - Intronic
1098319259 12:69224554-69224576 GAAAATGATGTGAACCCGGGAGG + Intergenic
1099544106 12:83955044-83955066 GTCCATGATGAGAAGACAGCTGG + Intergenic
1100055336 12:90502675-90502697 GAGAATGATGTGAACCCGGGAGG - Intergenic
1100199998 12:92288171-92288193 GACAATGGTGTGAACCCGGGAGG - Intergenic
1100512027 12:95284994-95285016 GAGAATGGTGTGAACCCGGCAGG + Intronic
1100544186 12:95585919-95585941 GAGAATGATGTGAACCCGGGAGG - Intergenic
1101440542 12:104701438-104701460 GTGCATGAAGTGAACCCGGCGGG + Intronic
1101793614 12:107953107-107953129 GAGAATGATGTGAACCCGGGAGG - Intergenic
1102157866 12:110744871-110744893 GCCAGGGATGTGAACACTGCTGG - Intergenic
1103696864 12:122822661-122822683 CTCAATGGTGTGAACCCGGGAGG - Intronic
1105367177 13:19775959-19775981 GAGAATGGTGTGAACACGGGAGG + Intronic
1106048939 13:26172631-26172653 GACAATGGCGTGAACCCGGCAGG - Intronic
1109072785 13:57789585-57789607 GAGAATGGTGTGAACACGGGAGG + Intergenic
1109802216 13:67395276-67395298 GACAATGGTGTGAACCCGGGAGG + Intergenic
1110914947 13:81009870-81009892 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1111797877 13:92946501-92946523 GACAATGGTGTGAACCCGGGAGG - Intergenic
1112452574 13:99525643-99525665 GAGAATGGTGTGAACTCGGCAGG - Intronic
1115995694 14:39193717-39193739 GAGAATGATGTGAACTCGGGAGG - Intergenic
1116130369 14:40848210-40848232 GAGAATGATGTGAACCCGGGAGG + Intergenic
1116267180 14:42707917-42707939 GAGAATGATGTGAACCCGGGAGG - Intergenic
1116576518 14:46582292-46582314 GACAATGGTGTGAACCCGGAAGG + Intergenic
1117351790 14:54888600-54888622 GTGAATGGTGTGAACCCGGGAGG - Intronic
1117730175 14:58714468-58714490 GAGAATGATGTGAACCCGGGAGG - Intergenic
1118263220 14:64267792-64267814 GAGAATGATGTGAACCCGGGAGG + Intronic
1120093497 14:80361520-80361542 GTCAATAATGTGTTCACGTCAGG - Intronic
1120494330 14:85215750-85215772 GAGAATGATGTGAACCCGGGAGG - Intergenic
1122142165 14:99668872-99668894 GTCAATGAGCTGCACACGGAAGG - Intronic
1122712362 14:103668565-103668587 GAGAATGATGTGAACCCGGGAGG - Intronic
1122713964 14:103682278-103682300 GAGAATGATGTGAACCCGGGAGG + Intronic
1122734299 14:103827244-103827266 GAGAATGGTGTGAACCCGGCAGG + Intronic
1122751199 14:103934690-103934712 GAGAATGGTGTGAACCCGGCAGG + Intronic
1123680363 15:22758398-22758420 GACAATGGTGTGAACCCGGGAGG + Intergenic
1124060624 15:26290463-26290485 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1124332576 15:28832863-28832885 GACAATGGTGTGAACCCGGGAGG + Intergenic
1124554301 15:30710736-30710758 GAGAATGACGTGAACCCGGCAGG + Intronic
1125712142 15:41795694-41795716 GACAATGGTGTGAACCCGGGAGG - Intronic
1125900025 15:43337184-43337206 GAGAATGATGTGAACCCGGGAGG + Intronic
1125998010 15:44182883-44182905 GAGAATGATGTGAACCCGGGAGG - Intronic
1126583126 15:50259070-50259092 GAGAATGATGTGAACCCGGGAGG + Intronic
1126700172 15:51359887-51359909 GAGAATGATGTGAACCCGGGAGG + Intronic
1128337530 15:66796918-66796940 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1128969924 15:72099545-72099567 TGCAGTGATGTGACCACGGCTGG - Intronic
1129499881 15:76025347-76025369 GAGAATGGTGTGAACCCGGCAGG + Intronic
1131195308 15:90350783-90350805 GAGAATGATGTGAACCCGGGAGG - Intergenic
1131438105 15:92438965-92438987 ATCAATGATATGAAAACGGGTGG - Intronic
1131461447 15:92620406-92620428 GACAATGGTGTGAACCCGGGAGG + Intronic
1132109751 15:99094107-99094129 GACAATGGTGTGAACCCGGGAGG - Intergenic
1132784613 16:1648967-1648989 GAGAATGGTGTGAACCCGGCAGG + Intronic
1132822269 16:1880396-1880418 GAGAATGATGTGAACCCGGGAGG - Intronic
1135029267 16:19024914-19024936 GAGAATGATGTGAACCCGGGAGG + Intronic
1135355042 16:21762044-21762066 GTCACTGATGTGATCCTGGCGGG + Intergenic
1135453526 16:22578186-22578208 GTCACTGATGTGATCCTGGCGGG + Intergenic
1135782719 16:25319179-25319201 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1137710795 16:50565280-50565302 GAGAATGGTGTGAACACGGGAGG + Intronic
1138476467 16:57273168-57273190 GTGAATGGTGTGAACTCGGGAGG + Intronic
1139070053 16:63369583-63369605 GAGAATGATGTGAACCCGGGGGG - Intergenic
1139602720 16:67996413-67996435 GGCAATGATGTGATCTTGGCGGG + Intronic
1140284759 16:73591601-73591623 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1140441769 16:74993349-74993371 GAGAATGGTGTGAACCCGGCAGG + Intronic
1140531956 16:75674281-75674303 GACAATGGTGTGAACCCGGGAGG + Intronic
1140589181 16:76331275-76331297 GACAATGGTGTGAACCCGGGAGG - Intronic
1141033384 16:80608559-80608581 GCCAATGATGTCATCACGGCTGG - Intronic
1141122317 16:81369679-81369701 GAGAATGGTGTGAACCCGGCAGG - Intronic
1142357573 16:89609547-89609569 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1142397451 16:89840337-89840359 GAGAATGATGTGAACCCGGGAGG - Intronic
1142649834 17:1341334-1341356 GACAATGGTGTGAACCCGGGAGG + Intergenic
1142663886 17:1450415-1450437 GAGAATGACGTGAACCCGGCAGG + Intronic
1142797315 17:2318552-2318574 GACAATGGTGTGAACCCGGGAGG - Intronic
1142860494 17:2757957-2757979 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1143707595 17:8709739-8709761 GAGAATGGTGTGAACACGGGAGG + Intergenic
1144317802 17:14080311-14080333 GAGAATGATGTGAACCCGGGAGG - Intronic
1144355884 17:14445706-14445728 GAGAATGCTGTGAACACGGGAGG + Intergenic
1144871374 17:18373707-18373729 GAGAATGATGTGAACCCGGGAGG + Intergenic
1144928409 17:18834272-18834294 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1145107188 17:20128222-20128244 GTCACTGATGTCAACACGCCTGG - Intronic
1145223760 17:21110384-21110406 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1146231787 17:31117581-31117603 GAGAATGACGTGAACACGGGAGG + Intronic
1147009045 17:37428954-37428976 GAGAATGATGTGAACCCGGGAGG + Intronic
1148597066 17:48865320-48865342 GACAATGGTGTGAACTCGGGAGG - Intronic
1149309962 17:55384053-55384075 GTCAATTATGTAGACATGGCAGG - Intergenic
1149476854 17:56968903-56968925 GAGAATGATGTGAACCCGGGAGG + Intergenic
1150778164 17:68098747-68098769 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1152348409 17:79768993-79769015 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1152359362 17:79824039-79824061 GACAATGGTGTGAACCCGGGAGG - Intergenic
1152731636 17:81974765-81974787 GAGAATGATGTGAACCCGGGAGG + Intergenic
1152834807 17:82522456-82522478 GAGAATGATGTGAACCCGGGAGG - Intronic
1153031772 18:720154-720176 GAGAATGATGTGAACCCGGGAGG - Intergenic
1153663281 18:7345042-7345064 GAGAATGATGTGAACCCGGGAGG + Intergenic
1153885563 18:9461768-9461790 GTCAATCATGTAAACACTGAAGG + Intergenic
1155459672 18:26063427-26063449 GACAATGGTGTGAACCCGGGAGG + Intronic
1155516845 18:26631958-26631980 GAGAATGGTGTGAACCCGGCAGG + Intronic
1155952991 18:31933209-31933231 GAGAATGGTGTGAACCCGGCGGG + Intronic
1156563036 18:38151047-38151069 GAGAATGGTGTGAACACGGGAGG - Intergenic
1156737138 18:40273938-40273960 GAGAATGGTGTGAACACGGGAGG + Intergenic
1157085648 18:44577672-44577694 GAGAATGATGTGAACCCGGGAGG + Intergenic
1158515600 18:58127749-58127771 GAGAATGGTGTGAACACGGGAGG + Intronic
1159811431 18:73022293-73022315 GAGAATGATGTGAACCCGGGAGG + Intergenic
1159900148 18:74038020-74038042 GGCAGTGATGAGAACACTGCAGG - Intergenic
1161062637 19:2222792-2222814 GAGAATGATGTGAACCCGGGAGG + Intronic
1161182908 19:2897313-2897335 GAGAATGGTGTGAACACGGGAGG - Intergenic
1161214082 19:3084641-3084663 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1161825313 19:6559877-6559899 GAGAATGGTGTGAACACGGGAGG + Intergenic
1162012552 19:7826643-7826665 GAGAATGGAGTGAACACGGCAGG + Intergenic
1162067366 19:8134150-8134172 GGGAATGATGTGAACCCGGGAGG + Intronic
1162677547 19:12311106-12311128 GACAATCATTTGAACCCGGCAGG + Intergenic
1163258283 19:16171046-16171068 GACAATGGTGTGAACCCGGGAGG + Intronic
1163860796 19:19741897-19741919 GACAATGGTGTGAACCCGGGAGG - Intergenic
1164165979 19:22675210-22675232 GACAATGGTGTGAACCCGGGAGG + Intergenic
1164746320 19:30617438-30617460 GAGAATGGTGTGAACCCGGCAGG - Intronic
1165016319 19:32882946-32882968 GAGAATGATGTGAACCCGGGAGG - Intronic
1165020288 19:32918972-32918994 GAGAATGATGTGAACCCGGGAGG - Intronic
1165752516 19:38269185-38269207 GAGAATGATGTGAACCCGGGAGG - Intronic
1165785102 19:38456954-38456976 GAGAATGATGTGAACCCGGGAGG + Intronic
1166034130 19:40154998-40155020 GAGAATGAAGTGAACCCGGCAGG + Intergenic
1166817514 19:45555578-45555600 GACAATGGTGTGAACCCGGGTGG - Intronic
1168116841 19:54226642-54226664 GAGAATGGTGTGAACCCGGCAGG - Intronic
1168525258 19:57083526-57083548 GACAATGGCGTGAACACGGGAGG + Intergenic
1168544491 19:57239676-57239698 GAGAATGATGTGAACCCGGGAGG - Intergenic
1168651346 19:58094319-58094341 GAGAATGGTGTGAACCCGGCAGG + Intronic
928638992 2:33277917-33277939 GAGAATGATGTGAACCCGGGAGG - Intronic
929672760 2:43890621-43890643 GACAATGGTGTGAACCCGGGAGG + Intronic
931320038 2:61167180-61167202 GAGAATGGTGTGAACCCGGCAGG - Intergenic
933741244 2:85536137-85536159 GAGAATGATGTGAACCCGGGAGG - Intergenic
934059738 2:88283055-88283077 TTCAATGATGGGAAAACGGAGGG + Intergenic
934920509 2:98340695-98340717 GAGAATGATGTGAACCCGGGAGG + Intronic
935775969 2:106471748-106471770 GAGAATGGTGTGAACCCGGCAGG + Intergenic
936002325 2:108845659-108845681 GAGAATGGTGTGAACACGGGAGG - Intronic
936365589 2:111851718-111851740 GAGAATGGTGTGAACCCGGCAGG + Intronic
937695391 2:124803023-124803045 GAGAATGATGTGAACCCGGGAGG + Intronic
938343708 2:130551519-130551541 GAGAATGATGTGAACCCGGGAGG + Intergenic
938346125 2:130569203-130569225 GAGAATGATGTGAACCCGGGAGG - Intergenic
939219775 2:139286800-139286822 GACAATGGTGTGAACCCGGGAGG + Intergenic
940459073 2:153939335-153939357 GTCACTGATGTGAACATGGTAGG + Intronic
941093158 2:161202277-161202299 GAGAATGATGTGAACCCGGGAGG - Intronic
942343510 2:174976034-174976056 GTGAATGGTGTGAACCCGGGAGG + Intronic
944588879 2:201198628-201198650 GAGAATGGTGTGAACACGGGAGG - Intronic
944738637 2:202590554-202590576 GAGAATGGTGTGAACCCGGCAGG - Intergenic
945217779 2:207453082-207453104 GAGAATGATGTGAACCCGGGAGG + Intergenic
945881946 2:215333950-215333972 GAGAATGGTGTGAACCCGGCAGG + Intronic
946429609 2:219618060-219618082 GAGAATGATGTGAACCCGGGAGG + Intergenic
946905877 2:224415522-224415544 GTCAATGATGTGGAGACAGAGGG + Intergenic
946953102 2:224898664-224898686 GAGAATGGTGTGAACCCGGCAGG - Intronic
947041710 2:225929371-225929393 GAGAATGATGTGAACCCGGGAGG - Intergenic
947993873 2:234511003-234511025 GAGAATGATGTGAACCCGGGAGG - Intergenic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
948972178 2:241437752-241437774 GTGAATGGTGTGAACACGGGAGG - Intronic
1169461333 20:5798390-5798412 GACAATGGTGTGAACCCGGGAGG - Intronic
1170137273 20:13088422-13088444 GAGAATGATGTGAACCCGGGAGG - Intronic
1173542295 20:43863245-43863267 GAGAATGATGTGAACCCGGGAGG - Intergenic
1174290494 20:49505031-49505053 GAGAATGGTGTGAACACGGGAGG + Exonic
1176182120 20:63754687-63754709 GAGAATGATGTGAACCCGGGAGG - Intronic
1176226036 20:64000039-64000061 GACAATGGTGTGAACCTGGCAGG - Intronic
1177195051 21:17895411-17895433 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1177496361 21:21897027-21897049 GAGAATGGTGTGAACACGGGAGG - Intergenic
1177554952 21:22677020-22677042 GTCAATGATATAACCAAGGCTGG - Intergenic
1178340516 21:31782168-31782190 GTCCATGCTGTGGACACAGCAGG + Intergenic
1178791198 21:35701891-35701913 GAGAATGACGTGAACCCGGCAGG - Intronic
1178897723 21:36573209-36573231 GTGAATGGTGTGAACCCGGGAGG + Intronic
1179666010 21:42912972-42912994 GAGAATGATGTGAACCCGGGAGG + Intronic
1180222549 21:46368356-46368378 GAGAATGATGTGAACCCGGGAGG + Intronic
1180749977 22:18117683-18117705 GAGAATGGTGTGAACCCGGCAGG + Intronic
1180870639 22:19144849-19144871 GTCAATGCTGTGAACACGAGGGG + Intergenic
1181011154 22:20041400-20041422 GACAATGGTGTGAACCCGGGAGG - Intronic
1181784640 22:25218167-25218189 GAGAATGGTGTGAACACGGGAGG + Intergenic
1181835137 22:25599500-25599522 GAGAATGATGTGAACCCGGGAGG + Intronic
1182238155 22:28893075-28893097 GAGAATGGTGTGAACCCGGCAGG + Intronic
1183039306 22:35164679-35164701 GAGAATGGCGTGAACACGGCAGG - Intergenic
1184796030 22:46733116-46733138 GTGAATGGTGTGAACCCGGGAGG + Intronic
949172444 3:1017365-1017387 GAGAATGATGTGAACCCGGGAGG - Intergenic
949272552 3:2236482-2236504 TTCAATGAATTGAACACAGCAGG - Intronic
949331964 3:2932910-2932932 GAGAATGATGTGAACCCGGGAGG - Intronic
950403890 3:12792557-12792579 GAGAATGATGTGAACCCGGGAGG - Intergenic
951618588 3:24576129-24576151 GAGAATGATGTGAACCCGGGAGG - Intergenic
951971771 3:28453932-28453954 GTGAATGGTGTGAACCCGGGAGG - Intronic
952243331 3:31557720-31557742 GACAATGGTGTGAACCCGGGAGG - Intronic
952339710 3:32435312-32435334 GAGAATGGTGTGAACCCGGCAGG + Intronic
952411150 3:33051141-33051163 GAGAATGATGTGAACCCGGGAGG + Intronic
956201477 3:66710474-66710496 GAGAATGGTGTGAACCCGGCAGG + Intergenic
957507896 3:81149108-81149130 GAGAATGATGTGAACCCGGAAGG - Intergenic
959364722 3:105442689-105442711 GAGAATGATGTGAACCCGGGAGG + Intronic
959639488 3:108616172-108616194 GAGAATGGTGTGAACACGGGAGG + Intronic
959664977 3:108910737-108910759 GAGAATGATGTGAACCCGGGAGG - Intronic
959943677 3:112105731-112105753 GCGAATGGTGTGAACCCGGCAGG + Intronic
960489360 3:118294490-118294512 GTTAATGTTCTGAACACTGCAGG - Intergenic
961585416 3:127918204-127918226 GTCAATGATGAGCACACTGCGGG - Intronic
961686888 3:128639362-128639384 GAGAATGATGTGAACCCGGAAGG + Intronic
962490615 3:135890596-135890618 GTCAATGAACTGAAGACTGCAGG - Intergenic
963770047 3:149379864-149379886 GAGAATGGTGTGAACCCGGCAGG + Intergenic
966175646 3:177135471-177135493 GAGAATGGTGTGAACCCGGCTGG - Intronic
966446329 3:180005637-180005659 GAGAATGGTGTGAACACGGGAGG + Intronic
967424603 3:189312289-189312311 GAGAATGATGTGAACCCGGGAGG - Intronic
967505024 3:190244069-190244091 GACAATGGTGTGAACCTGGCAGG + Intergenic
968208527 3:196826259-196826281 GACAATGACGTGAACCCGGGAGG - Intronic
968299126 3:197599948-197599970 GAGAATGACGTGAACACGGGAGG - Intergenic
968354193 3:198089615-198089637 GAGAATGATGTGAACCCGGGAGG + Intergenic
968378590 4:67954-67976 GACAATGGTGTGAACATGGGAGG - Intronic
968402724 4:312519-312541 GAAAATGATGTGAACCCGGGAGG + Intergenic
968760340 4:2439583-2439605 GTCATTGATGTGTACAGTGCTGG - Intronic
968824128 4:2880563-2880585 GACAATGGTGTGAACCCGGGAGG - Intronic
970058346 4:12000766-12000788 GACAATGGTGTGAACCCGGGAGG - Intergenic
971511786 4:27435684-27435706 GAGAATGATGTGAACATGGGAGG - Intergenic
971656285 4:29349482-29349504 GAGAATGGTGTGAACACGGGAGG + Intergenic
971776290 4:30970382-30970404 GAGAATGGCGTGAACACGGCAGG - Intronic
973198198 4:47469714-47469736 GTCAAGGAGGTGAACTTGGCTGG + Intergenic
974025275 4:56728215-56728237 TTCAAAGATGAGAACTCGGCCGG + Intergenic
975864141 4:78708596-78708618 GAGAATGGTGTGAACCCGGCAGG + Intergenic
976611534 4:87035469-87035491 GAGAATGATGTGAACCCGGGAGG + Intronic
977077600 4:92476113-92476135 GAGAATGGTGTGAACACGGGAGG - Intronic
978066234 4:104406344-104406366 GAGAATGATGTGAACCCGGGAGG - Intergenic
979112983 4:116782194-116782216 GAGAATGGTGTGAACCCGGCAGG + Intergenic
979363856 4:119796646-119796668 GAGAATGATGTGAACCCGGGAGG - Intergenic
982073537 4:151716875-151716897 CTCATTGATTTGAACAGGGCAGG - Exonic
982356181 4:154471894-154471916 GTCGGTGATTTGAACACTGCTGG + Intronic
982675626 4:158372728-158372750 GAGAATGATGTGAACCCGGGAGG - Intronic
983247953 4:165310233-165310255 GAGAATGGTGTGAACACGGGAGG + Intronic
983441355 4:167790794-167790816 GACAATGGCGTGAACCCGGCAGG - Intergenic
984054051 4:174904389-174904411 GAGAATGATGTGAACCCGGGAGG - Intronic
984268325 4:177520480-177520502 GAGAATGATGTGAACCCGGGAGG + Intergenic
986391357 5:7290378-7290400 GACAATGGTGTGAACTCGGGAGG + Intergenic
987013667 5:13794875-13794897 GACAATGGTGTGAACCCGGGAGG + Intronic
987527409 5:19070663-19070685 GAGAATGATGTGAACTCGGGAGG + Intergenic
987718077 5:21596974-21596996 GAGAATGATGTGAACCCGGGAGG + Intergenic
987996797 5:25292484-25292506 GAGAATGATGTGAACCCGGGAGG + Intergenic
991227620 5:64291512-64291534 GAGAATGGTGTGAACCCGGCAGG - Intronic
991675669 5:69087802-69087824 GAGAATGATGTGAACCCGGGAGG + Intergenic
991685766 5:69181069-69181091 GTGAATGGTGTGAACCCGGCGGG - Intergenic
992890357 5:81198527-81198549 GAGAATGGTGTGAACCCGGCAGG - Intronic
994044528 5:95293100-95293122 GCCAATAATCTGAACAAGGCTGG - Intergenic
994303913 5:98179723-98179745 GAGAATGGTGTGAACACGGGAGG + Intergenic
997494441 5:134310273-134310295 GAGAATGGTGTGAACACGGGAGG - Intronic
997633944 5:135390689-135390711 GTCAATGCTGTGACCACTGGAGG + Intronic
998011099 5:138696301-138696323 GACAATGGTGTGAACTCGGGAGG + Intronic
998116002 5:139537872-139537894 GAGAATGATGTGAACCCGGGAGG + Intronic
1001367624 5:171159831-171159853 GAGAATGATGTGAACCCGGGAGG + Intronic
1002114477 5:176947726-176947748 GAGAATGATGTGAACCCGGGAGG + Intronic
1003064942 6:2896117-2896139 CTCACTGAAGTGAACAAGGCTGG - Exonic
1005110157 6:22272293-22272315 GACAATGGTGTGAACCCGGGAGG + Intergenic
1006079485 6:31557195-31557217 GAGAATGATGTGAACCCGGGAGG - Intronic
1006107536 6:31725415-31725437 GAGAATGGTGTGAACCCGGCAGG - Intronic
1006762228 6:36473148-36473170 GTGAATGGTGTGAACCCGGGAGG - Intronic
1006943423 6:37768005-37768027 GAGAATGATGTGAACCCGGGAGG - Intergenic
1006993732 6:38238560-38238582 GACAATGGTGTGAACCCGGGAGG - Intronic
1007676117 6:43596391-43596413 GAGAATGGTGTGAACCCGGCAGG + Intronic
1008229712 6:48970380-48970402 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1010548231 6:77185516-77185538 GAGAATGATGTGAACCCGGGAGG + Intergenic
1010736053 6:79444545-79444567 GAGAATGATGTGAACCCGGGAGG + Intergenic
1010925613 6:81742372-81742394 GACAATGGTGTGAACCCGGGAGG + Intronic
1011336276 6:86264566-86264588 GTCAAGGTTGTGAACATGGTGGG - Intergenic
1011919632 6:92556123-92556145 GTGAATGGTGTGAACACAGGAGG + Intergenic
1013773862 6:113657156-113657178 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1014235221 6:118946522-118946544 GAGAATGGTGTGAACACGGGAGG + Intergenic
1017198373 6:151726419-151726441 GAGAATGGTGTGAACCCGGCAGG - Intronic
1018220545 6:161573628-161573650 GAGAATGGTGTGAACCCGGCAGG + Intronic
1018640088 6:165897582-165897604 TTCAATGATGGGATCATGGCAGG + Intronic
1019124296 6:169828840-169828862 GTCAATGTTGTGCACAGGGAGGG + Intergenic
1019308081 7:345683-345705 GAGAATGGTGTGAACACGGGAGG + Intergenic
1019894347 7:3972167-3972189 GACAATGGTGTGAACCCGGGAGG - Intronic
1020614751 7:10444041-10444063 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1020980286 7:15058640-15058662 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1021065439 7:16167016-16167038 GACAATGGTGTGAACCCGGGAGG - Intronic
1023172879 7:37406517-37406539 GACAATGGTGTGAACCCGGGAGG - Intronic
1023428227 7:40062373-40062395 GAGAATGATGTGAACCCGGGAGG - Intronic
1024035149 7:45501574-45501596 GAGAATGATGTGAACCCGGGAGG + Intergenic
1024384548 7:48736800-48736822 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1024648086 7:51385346-51385368 GAGAATGGCGTGAACACGGCAGG - Intergenic
1024873117 7:53989218-53989240 GAGAATGGTGTGAACACGGGAGG - Intergenic
1024928251 7:54640857-54640879 GAGAATGACGTGAACCCGGCAGG + Intergenic
1025061973 7:55817557-55817579 GAGAATGATGTGAACCCGGGAGG - Intronic
1026516851 7:71080200-71080222 GAGAATGATGTGAACCCGGGAGG + Intergenic
1026605666 7:71813839-71813861 GAGAATGGTGTGAACACGGGAGG + Intronic
1029097571 7:98101083-98101105 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1029370212 7:100145355-100145377 GAGAATGATGTGAACCCGGGAGG + Intergenic
1029921842 7:104273552-104273574 GAGAATGATGTGAACTCGGGAGG - Intergenic
1030054052 7:105566186-105566208 GAGAATGATGTGAACCCGGGAGG + Intronic
1030460919 7:109835041-109835063 ATAAATGATGTGAACAGGGGTGG - Intergenic
1033095579 7:138427681-138427703 GAGAATGATGTGAACCCGGAAGG + Intergenic
1033360247 7:140634086-140634108 GACAATGGTGTGAACCCGGTAGG - Intronic
1035394602 7:158526816-158526838 GTCCAAGATGAGAGCACGGCAGG - Intronic
1036255162 8:7200144-7200166 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1036362327 8:8087363-8087385 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1036718007 8:11144799-11144821 GTTTAGGATGTGAACAAGGCAGG - Intronic
1036942870 8:13068141-13068163 GAGAATGGTGTGAACCCGGCAGG - Intergenic
1036954823 8:13176487-13176509 GAGAATGGTGTGAACCCGGCAGG + Intronic
1037303962 8:17485549-17485571 GAGAATGACGTGAACCCGGCAGG - Intergenic
1037848382 8:22305280-22305302 GAGAATGATGTGAACCCGGGAGG - Intronic
1038166987 8:25095057-25095079 GACAATGGTGTGAACCCGGGAGG - Intergenic
1039526024 8:38217066-38217088 GAGAATGATGTGAACCCGGGAGG + Intergenic
1040865955 8:52049161-52049183 ATCAATGATGGGATCACAGCTGG - Intergenic
1041941116 8:63389072-63389094 GAGAATGATGTGAACCCGGGAGG - Intergenic
1042474168 8:69226763-69226785 GAGAATGATGTGAACCCGGGAGG - Intergenic
1043249203 8:78048668-78048690 GAGAATGATGTGAACCCGGGAGG + Intergenic
1043618176 8:82154207-82154229 GACAATGGTGTGAACCCGGGAGG - Intergenic
1044396607 8:91720641-91720663 GAGAATGATGTGAACCCGGGAGG - Intergenic
1044846197 8:96384448-96384470 GTCAATCAAGTCAACACAGCAGG - Intergenic
1046429551 8:114107345-114107367 GAGAATGGTGTGAACACGGGAGG - Intergenic
1046626629 8:116583041-116583063 GAGAATGATGTGAACCCGGGAGG + Intergenic
1047228570 8:122976753-122976775 GAGAATGGTGTGAACACGGGAGG + Intergenic
1047894371 8:129349579-129349601 GAGAATGACGTGAACACGGGAGG + Intergenic
1048517584 8:135124761-135124783 GAGAATGATGTGAACCCGGGAGG - Intergenic
1048624794 8:136173106-136173128 GAGAATGATGTGAACCCGGGAGG + Intergenic
1049281974 8:141754099-141754121 GAGAATGGTGTGAACACGGGAGG - Intergenic
1050497751 9:6262508-6262530 GAGAATGATGTGAACCCGGAAGG + Intergenic
1050524041 9:6530080-6530102 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1050664749 9:7922638-7922660 GTGAAAGAAGTGAACACAGCAGG + Intergenic
1050842532 9:10170595-10170617 GAGAATGATGTGAACCCGGGAGG + Intronic
1051447950 9:17162202-17162224 GAGAATGGCGTGAACACGGCAGG - Intronic
1051497981 9:17746163-17746185 GAGAATGGTGTGAACACAGCGGG - Intronic
1051750818 9:20339102-20339124 GAGAATGGCGTGAACACGGCAGG + Intergenic
1052600162 9:30616859-30616881 GAGAATGGTGTGAACACGGGAGG + Intergenic
1052932304 9:34065982-34066004 GAGAATGGTGTGAACACGGGAGG - Intergenic
1054201575 9:62088212-62088234 GAGAATGACGTGAACCCGGCAGG + Intergenic
1054636783 9:67500147-67500169 GAGAATGACGTGAACCCGGCAGG - Intergenic
1055704257 9:78980309-78980331 GAGAATGATGTGAACCCGGGAGG + Intergenic
1055952936 9:81747359-81747381 GAGAATGATGTGAACCCGGGAGG + Intergenic
1057145121 9:92753626-92753648 GAGAATGATGTGAACCCGGAAGG - Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057764950 9:97908320-97908342 GTGAATGGTGTGAACCCGGGAGG + Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1059462102 9:114438540-114438562 GAGAATGGTGTGAACACGGGAGG - Intronic
1059776553 9:117481663-117481685 CTCAATGTTGTGATCACAGCTGG - Intergenic
1060383925 9:123204832-123204854 GAAAATGATGTGAACCCGGAAGG + Intronic
1060602710 9:124888787-124888809 GAGAATGATGTGAACCCGGGAGG - Intronic
1061103576 9:128511614-128511636 GAGAATGATGTGAACGCGGGAGG + Intronic
1203570648 Un_KI270744v1:126296-126318 GACAATGGTGTGAACATGGGAGG + Intergenic
1187330711 X:18336645-18336667 GAGAATGATGTGAACCCGGGAGG + Intronic
1188880882 X:35490801-35490823 GAGAATGATGTGAACCCGGGAGG - Intergenic
1189311214 X:40019264-40019286 GAGAATGGTGTGAACACGGGAGG - Intergenic
1190750943 X:53360674-53360696 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1190961538 X:55254362-55254384 GAGAATGGTGTGAACCCGGCAGG + Intronic
1194334262 X:92626117-92626139 GTGAATGGTGTGAACTCGGGAGG + Intergenic
1194650064 X:96503973-96503995 GAGAATGATGTGAACCCGGGAGG - Intergenic
1194860664 X:98994767-98994789 GAGAATGGTGTGAACACGGGAGG - Intergenic
1196259000 X:113555637-113555659 GAGAATGATGTGAACCCGGGAGG - Intergenic
1197621574 X:128756441-128756463 GGGAATGGTGTGAACACGGGAGG - Intergenic
1197742359 X:129905055-129905077 GTGAATGGTGTGAACCCGGGAGG + Intergenic
1198198859 X:134394628-134394650 GAGAATGATGTGAACCCGGGAGG - Intronic
1198835609 X:140801960-140801982 GAGAATGATGTGAACCCGGGAGG - Intergenic
1199519390 X:148718375-148718397 GGCAATGATGTGAACTGGGAAGG + Intronic
1200829480 Y:7677106-7677128 GTCAATTATGTTACCAAGGCTGG + Intergenic
1200832422 Y:7699968-7699990 GAGAATGGTGTGAACCCGGCAGG + Intergenic
1201546664 Y:15172743-15172765 GAGAATGGTGTGAACACGGAAGG - Intergenic
1201695172 Y:16816773-16816795 GAGAATGATGTGAACCCGGGAGG + Intergenic
1202272779 Y:23086649-23086671 GACAATGGTGTGAACCCGGGAGG - Intergenic
1202293247 Y:23334033-23334055 GACAATGGTGTGAACCCGGGAGG + Intergenic
1202425776 Y:24720393-24720415 GACAATGGTGTGAACCCGGGAGG - Intergenic
1202445013 Y:24949693-24949715 GACAATGGTGTGAACCCGGGAGG + Intergenic