ID: 948400601

View in Genome Browser
Species Human (GRCh38)
Location 2:237682174-237682196
Sequence TCTAGAGCCCCTTGTTTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948400599_948400601 -4 Left 948400599 2:237682155-237682177 CCTGGATGTAAATTGTAATTCTA 0: 1
1: 0
2: 2
3: 19
4: 205
Right 948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG 0: 1
1: 1
2: 0
3: 8
4: 92
948400595_948400601 16 Left 948400595 2:237682135-237682157 CCTTCCCGCAACTTCTCTAACCT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG 0: 1
1: 1
2: 0
3: 8
4: 92
948400597_948400601 12 Left 948400597 2:237682139-237682161 CCCGCAACTTCTCTAACCTGGAT 0: 1
1: 1
2: 2
3: 21
4: 211
Right 948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG 0: 1
1: 1
2: 0
3: 8
4: 92
948400598_948400601 11 Left 948400598 2:237682140-237682162 CCGCAACTTCTCTAACCTGGATG 0: 1
1: 1
2: 1
3: 12
4: 191
Right 948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG 0: 1
1: 1
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948400601 Original CRISPR TCTAGAGCCCCTTGTTTTGC GGG Intronic
902743570 1:18457774-18457796 TATTGAGCCCCGTGTTGTGCTGG + Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904594668 1:31635769-31635791 TGTGGAGCCCCTTGATGTGCAGG - Intronic
906621087 1:47280085-47280107 TCTAGGCCCTCTTGTTTTACAGG - Intronic
907817157 1:57930089-57930111 TCTAGATTCACTTTTTTTGCAGG + Intronic
908987692 1:70044578-70044600 TCTTCAGCCCATTTTTTTGCAGG + Intronic
911447821 1:98020592-98020614 TATAGAGTCCCCTGTTTTGCTGG + Intergenic
920898673 1:210084102-210084124 TTTAGCGCCACTTGGTTTGCTGG + Intronic
921253427 1:213318347-213318369 GCTAAAGGCCCTTGTCTTGCAGG + Intergenic
923240150 1:232076702-232076724 TCTAGAGCCACTTTTCTTCCTGG - Intergenic
923240308 1:232078281-232078303 TCTAGAGCCACTTTTCTTCCTGG - Intergenic
923409362 1:233691738-233691760 TCTAGAGCCCATCACTTTGCAGG + Intergenic
1073254117 10:102140153-102140175 TCTAGAGGGCCTTCTTTAGCAGG - Exonic
1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG + Intronic
1082846145 11:57727276-57727298 TCTAGAGTCCTTTGATTTGATGG - Intronic
1089047864 11:115519262-115519284 TCTAGAGCCTCTTTATTTGCAGG + Intergenic
1092756448 12:11767877-11767899 TCTATAGCAACTTGTTTTGAGGG + Intronic
1094787394 12:33864512-33864534 TCTGCAGCCCCTTGATTTGTGGG + Intergenic
1096463913 12:51837728-51837750 CCTGGAGCCCCTTGTGTTCCTGG - Intergenic
1101949713 12:109165129-109165151 GGTAGACTCCCTTGTTTTGCTGG - Intronic
1106124072 13:26885760-26885782 TCTAGAAGCCTTTGTTGTGCTGG + Intergenic
1113980188 13:114268197-114268219 TCTAGAGAGCCTTCATTTGCAGG - Intronic
1115136140 14:30110280-30110302 ACTGGAGACCCTTGTTTTTCAGG + Intronic
1118989511 14:70785002-70785024 TCTCTAGCACCTTGTTCTGCAGG - Intronic
1124874705 15:33581019-33581041 TCTAAATCCCCTTTTTTTGCAGG + Intronic
1124955065 15:34354954-34354976 TGTAAAGCCCCTTGTTTCACAGG + Intronic
1125118654 15:36125772-36125794 TCTGGAGCACCATGTTTTGTTGG + Intergenic
1127327892 15:57913281-57913303 TCCAGAGCCCCTGGGTTTCCAGG + Intergenic
1130660914 15:85830918-85830940 CCTAGAGCCCCTTATCATGCAGG + Intergenic
1132104090 15:99050452-99050474 TCTAGCCCCCATTCTTTTGCTGG + Intergenic
1132427489 15:101730760-101730782 CGTAGAGCACTTTGTTTTGCTGG + Intergenic
1135132569 16:19864828-19864850 TCTAGAAACCCTTGCTTTGCTGG - Intronic
1141382419 16:83588237-83588259 TCTAGAAAGCCTGGTTTTGCGGG - Intronic
1141922828 16:87147355-87147377 TCTATAGCCTCTGGTGTTGCTGG - Intronic
1149087684 17:52738669-52738691 TCTAGAGTTCCTTTTTTTGGTGG + Intergenic
1149556672 17:57578391-57578413 GGCAGAGCCCCTTGTTCTGCGGG - Intronic
1157368113 18:47085139-47085161 TTTACAGCCCCTTGATTTCCTGG + Intronic
1157444633 18:47735364-47735386 TCAATAGCCCATTGTTCTGCTGG - Intergenic
1160910550 19:1471929-1471951 TCTGGAGCTCCTTGTCCTGCAGG - Exonic
1161339639 19:3734224-3734246 TCTAGGGCCCTTTGTTTAGAGGG + Intronic
1166357651 19:42236551-42236573 TCCAGAGCCCCTGGCTTTGTGGG + Intronic
925748205 2:7062896-7062918 TCTAGAAACTCTTCTTTTGCTGG + Intronic
929671538 2:43879622-43879644 TCTAGATCCCCTTGCTATGGAGG - Intergenic
933346643 2:81094860-81094882 TCTAGAGACATTGGTTTTGCAGG - Intergenic
933588276 2:84203342-84203364 CCTAGAGCACCTTGTTTCCCAGG + Intergenic
936953186 2:117998749-117998771 TCTAGAGATCCATGTTTTGGGGG + Intronic
946562914 2:220933193-220933215 TCTAGGGCCACTTCTTCTGCTGG - Intergenic
947138784 2:227001489-227001511 TGCAAAGCCCCTTGTTTTACGGG - Intergenic
947639669 2:231699996-231700018 TCTAGAGACGCTTGCTCTGCCGG + Intergenic
948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG + Intronic
1169632837 20:7652346-7652368 TCCAAAGCCCCCTGTTTTGAAGG + Intergenic
1173829902 20:46076069-46076091 TTTATAACACCTTGTTTTGCTGG - Intronic
1174203210 20:48821370-48821392 TCTGAATCTCCTTGTTTTGCAGG - Intronic
1174870955 20:54181704-54181726 ACTTGAGGCCCTTGATTTGCTGG + Intergenic
1178168589 21:30011306-30011328 TGTAGTGCCTCTTGTATTGCAGG + Intergenic
1179173287 21:38989643-38989665 TACAGAGCCCCTTTATTTGCAGG - Intergenic
1181348670 22:22239629-22239651 TCTTTAGCCTCTTGTTCTGCGGG - Intergenic
1183799705 22:40152001-40152023 TCTAGAATCTCTTGTTTTTCAGG - Intronic
950200668 3:11040813-11040835 CCCAGAGCCCCATGTTTTGAAGG + Intergenic
954055304 3:48018340-48018362 TTTTTAGCCCCTTGTTTTGTTGG - Intronic
955953642 3:64266820-64266842 TCTAGAAGCCCTTATTTTGCTGG - Intronic
970783635 4:19769621-19769643 TAAGGAGCCCCTTGTTTTGCTGG - Intergenic
971410004 4:26360437-26360459 TCTAGTGCCTATTGTGTTGCGGG + Intronic
972680152 4:41298581-41298603 TCTAGAGCCCCCTCATTTGAGGG + Intergenic
973316125 4:48762296-48762318 CATAGAGCCTATTGTTTTGCAGG + Intronic
980418201 4:132521009-132521031 TGTAGAGCCTTTTCTTTTGCTGG + Intergenic
992378409 5:76212573-76212595 TCTGGAGCCCCTTGTCTCCCTGG + Intronic
996262433 5:121490314-121490336 TCTAGAACACCTTTTTTTCCAGG + Intergenic
996669799 5:126103990-126104012 TTTATAACCCTTTGTTTTGCTGG - Intergenic
999857071 5:155606518-155606540 TCTAGTACCCCTTTTTATGCTGG + Intergenic
1003370840 6:5524343-5524365 TGTAGAGGCCCTTGGTTTCCTGG + Intronic
1003995482 6:11536896-11536918 TCTAGCCCCCCTTTTTTTGATGG - Intergenic
1005870575 6:29971902-29971924 CCTAGAGCCCCTGGTGCTGCTGG + Intergenic
1005960039 6:30687660-30687682 TCTGAAGTCCTTTGTTTTGCGGG + Exonic
1006099432 6:31676965-31676987 TATAGAGCCCTCTGTTTTGAGGG + Exonic
1007763987 6:44150394-44150416 TCTTGGGCCCCTTGCTTTGTAGG - Intronic
1010773348 6:79857938-79857960 TCCCAAGCCCCTTGTTTTCCTGG - Intergenic
1016519897 6:144935381-144935403 TCTGGACCCCATTGTTTTGAAGG - Intergenic
1018634265 6:165847064-165847086 ACCAGTGCCCCTTGTTTTGACGG + Intronic
1027255218 7:76426524-76426546 ACTCGAGGCCCTTGTTTTCCTGG + Intronic
1031706818 7:124991203-124991225 TGTAGAGCTCCTTGTTGGGCTGG + Intergenic
1032056356 7:128687773-128687795 TGCAAAGCCCCTTGTATTGCTGG + Intergenic
1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG + Intergenic
1041340015 8:56835158-56835180 TCTTGAGCTCCTAGTTTTCCTGG - Intergenic
1050388754 9:5114649-5114671 GCCAGAGCCCTTGGTTTTGCGGG - Intronic
1059520375 9:114935100-114935122 TTTAGAGCTCTTTGTCTTGCTGG + Intergenic
1187757417 X:22543050-22543072 TCTAGAGCCCCATTTATTGCTGG + Intergenic
1193741765 X:85225826-85225848 TCCAGAGCCCCTTGTGCTCCAGG + Intergenic
1194925581 X:99819843-99819865 TTGAGAGCCCCTTGGTCTGCTGG + Intergenic
1200827183 Y:7657731-7657753 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1200829894 Y:7679621-7679643 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1200951336 Y:8902543-8902565 TCTTGAGCACCTTGTGTTTCTGG + Intergenic
1200958402 Y:8973319-8973341 TCTTGAGCACCTTGTGTTTCTGG + Intergenic
1200988376 Y:9326518-9326540 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1201018084 Y:9624952-9624974 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1201060037 Y:10036960-10036982 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1202119634 Y:21509674-21509696 TCTTGAGCACCTTGTGTTTCTGG + Intergenic
1202122087 Y:21533215-21533237 TCTTGAGCACCTTGTGTTTCTGG + Intronic
1202156920 Y:21896168-21896190 TCTTGAGCACCTTGTGTTTCTGG - Intronic
1202159366 Y:21919709-21919731 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1202185814 Y:22184624-22184646 TCTTGAGCACCTTGTGTTTCTGG - Intergenic
1202205546 Y:22401772-22401794 TCTTGAGCACCTTGTGTTTCTGG + Intronic