ID: 948400754

View in Genome Browser
Species Human (GRCh38)
Location 2:237683186-237683208
Sequence CCTTGTCTCCACCCCGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948400754_948400762 23 Left 948400754 2:237683186-237683208 CCACCAACGGGGTGGAGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 948400762 2:237683232-237683254 AGCAACTAAAATCAAGCCGACGG 0: 1
1: 0
2: 0
3: 0
4: 100
948400754_948400761 -6 Left 948400754 2:237683186-237683208 CCACCAACGGGGTGGAGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 948400761 2:237683203-237683225 ACAAGGGGCGAGGGCTTCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 143
948400754_948400763 28 Left 948400754 2:237683186-237683208 CCACCAACGGGGTGGAGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948400754 Original CRISPR CCTTGTCTCCACCCCGTTGG TGG (reversed) Intronic
900206430 1:1433757-1433779 CGCTGTCTCCACCCCGGAGGAGG - Intergenic
900502076 1:3011291-3011313 CCTTGCCTCCTCCCCGCTTGTGG + Intergenic
906146830 1:43565505-43565527 CCGAGTCTCCACACCGTTTGCGG - Intronic
907331735 1:53676234-53676256 CCTTGTCCCCACCCCTTAAGTGG - Intronic
907497349 1:54853777-54853799 CCCTGACTCCACCACCTTGGAGG + Intronic
914845663 1:151282423-151282445 CCTTGGCTCCGCCCCCTTGGGGG + Intronic
916079652 1:161224447-161224469 CCTTGTCTCACTCCTGTTGGGGG + Intergenic
918251930 1:182710569-182710591 CCTTCTCTTCTCCCCATTGGTGG - Intergenic
923786405 1:237072431-237072453 CCTTGTCTCTGCCCCTTTGCTGG - Intronic
1063822242 10:9849827-9849849 CCTTGTATCCTCCCTGCTGGAGG + Intergenic
1067807372 10:49402418-49402440 CCTTGTCTCCACCGCCCTAGAGG + Intergenic
1067854483 10:49780404-49780426 CCTTGTCTCCACCACCCTAGAGG + Intergenic
1083140197 11:60715170-60715192 CCTTGTCTCCACCTTTTTGGGGG - Intronic
1083207578 11:61161689-61161711 CCTGGTCTCCGCCCAGTGGGCGG - Intergenic
1083708856 11:64535084-64535106 CACCGTCTCCACCCCCTTGGAGG + Intergenic
1084376407 11:68781064-68781086 CCTTGGCTCCACCCTGCAGGGGG + Intronic
1084409932 11:69001077-69001099 CCTTGTCACCAGCCCGTCGAAGG + Intergenic
1086562914 11:88188753-88188775 CCTTATCTCCACCCCCATTGGGG + Intergenic
1087423904 11:97966340-97966362 TTTTCTCTCCACCCCCTTGGTGG - Intergenic
1092385582 12:8033520-8033542 AGTTGTCTCCTCCCCCTTGGGGG - Exonic
1095995877 12:48084144-48084166 CCTTGTACCCAGCCTGTTGGAGG + Intronic
1103600408 12:122051036-122051058 CCTTGTTTCTCCCACGTTGGGGG + Intronic
1109915879 13:68984766-68984788 CCTGGTCTCCGCGCCGTTGAGGG - Intergenic
1112706093 13:102070387-102070409 CCTTTTCTCCACATCTTTGGTGG - Intronic
1113347107 13:109489691-109489713 CCTTGTGTCCACCTCCCTGGGGG + Intergenic
1120580177 14:86237877-86237899 CTTTGTCCTCACCCCGATGGTGG - Intergenic
1121693084 14:95891848-95891870 CCCTGTCTCCTCCCGGTTGCTGG + Intergenic
1122066336 14:99176356-99176378 CCTTGTCTCCTCCTGGCTGGGGG + Intronic
1124606365 15:31172773-31172795 GCTTGCCTCCACCCTGTGGGTGG + Intergenic
1130518454 15:84644246-84644268 CCTTGTCTCCTACTCGATGGGGG + Intronic
1132199308 15:99938046-99938068 CCTTGTATCAACTCTGTTGGTGG - Intergenic
1135591885 16:23711018-23711040 CTTTGTCTCTACCCCCTTGCAGG - Exonic
1135929725 16:26726305-26726327 CCTTCTCTCCACACTGTTGTAGG + Intergenic
1136110506 16:28061764-28061786 CCTTGTGAGCTCCCCGTTGGAGG - Intronic
1143864912 17:9916840-9916862 CCTTGTCTCCAGGGCTTTGGAGG - Exonic
1147376110 17:40023296-40023318 CATTGTGTCCACCCCGGTGGAGG + Exonic
1147913213 17:43870329-43870351 CCTTGCCTCCACCATGTTGCTGG - Intergenic
1151436224 17:74099493-74099515 CCTTCTCTCCACCTGCTTGGTGG + Intergenic
1152686218 17:81695051-81695073 CCTCACCTCCACCACGTTGGTGG - Exonic
1166953595 19:46446983-46447005 CCTTCTCTCCTGCCCCTTGGAGG - Intergenic
926143693 2:10384168-10384190 CCTTGTCCCCACCCTGAGGGAGG - Intronic
926401807 2:12504734-12504756 CCTCATCTCCTCCCCGATGGTGG + Intergenic
928114676 2:28538441-28538463 CCATTTCCCCACCCCGGTGGAGG - Intronic
929081998 2:38130196-38130218 CCTTGCCTCACCCCCATTGGGGG - Intergenic
934571288 2:95374751-95374773 GCCTCTCTCCACCCCCTTGGGGG - Intronic
934618123 2:95787829-95787851 CCTTTTCTCTGCCCCGCTGGTGG + Intergenic
934642770 2:96036730-96036752 CCTTTTCTCTGCCCCGCTGGTGG - Intronic
934771057 2:96907818-96907840 CCTTGTCTTCACTCCCTGGGAGG + Intronic
935693839 2:105753593-105753615 CCTTGTCTCCTCCACACTGGGGG + Intronic
936237086 2:110751731-110751753 CCTTGCCTCCACCCTCCTGGAGG + Intronic
948400754 2:237683186-237683208 CCTTGTCTCCACCCCGTTGGTGG - Intronic
1171769424 20:29311054-29311076 CCCTGACTCCACCGCCTTGGAGG - Intergenic
1171907124 20:30908338-30908360 CCCTGCCTCCACCGCCTTGGAGG + Intergenic
1172611372 20:36255315-36255337 CCCTGGCTCCACCCCCTGGGGGG - Intronic
1173006458 20:39143114-39143136 CCTCCTCTTCTCCCCGTTGGCGG + Intergenic
1180100474 21:45581640-45581662 CCTGGGCTCCACCCAGTAGGGGG - Intergenic
1181933203 22:26419587-26419609 CCATTTCTGCACCCAGTTGGGGG - Intergenic
1183075743 22:35425823-35425845 CCTTTTCTCCACCCCTGTGGTGG + Intergenic
1183984181 22:41560568-41560590 GCTTGTCTCGACCCCTCTGGGGG + Intergenic
950021995 3:9793597-9793619 CCCTGCTTCCACCCCATTGGAGG + Intronic
950478887 3:13232520-13232542 GCTTGTCACCACCCCGTGAGAGG - Intergenic
951043173 3:18010778-18010800 CCATATCTCCACCCCTTTGCTGG + Intronic
959525007 3:107366982-107367004 CCCTGTCTCCACCCCCTCAGAGG - Intergenic
962799539 3:138878535-138878557 CCTTTTCTCCACTTCCTTGGTGG + Intergenic
964331198 3:155605162-155605184 CTTTGTCTCCACCACGTGGAGGG + Intronic
975420013 4:74152672-74152694 CCTTGTCTCCACCCCCTGACAGG + Intronic
979534183 4:121801051-121801073 TCTAGTCTCCACCCCGTGAGAGG + Intergenic
980039297 4:127920824-127920846 CCATGTATACACCCTGTTGGGGG + Exonic
980984537 4:139682952-139682974 CCTGGTCTCCAGCTCGTGGGTGG - Intronic
981066417 4:140491293-140491315 CCTCATCTCCATCCAGTTGGGGG - Intronic
996502068 5:124228552-124228574 CCTTTTCTACTCCCCTTTGGGGG - Intergenic
1002613309 5:180435519-180435541 CCTTGTCTCCTGCCAGTGGGGGG - Intergenic
1002639830 5:180625499-180625521 CCAGGTCCCCACCCCGCTGGAGG + Intronic
1003283094 6:4711198-4711220 CCATGTCTCCACAGCGTTAGAGG - Intronic
1008516922 6:52327247-52327269 CCTTCTTTCCAGCCAGTTGGTGG + Intergenic
1008887551 6:56447409-56447431 CCTTGTCTTCTACCCATTGGTGG + Intergenic
1015692839 6:135944534-135944556 CCTTGTCTTCACCTCCCTGGAGG - Intronic
1019262192 7:87868-87890 CCTTCTCTCCCCACCATTGGTGG - Intergenic
1019478979 7:1257376-1257398 CCTTGTCTCCTGCCCCATGGCGG - Intergenic
1024256787 7:47545565-47545587 CCTGGTCTCCCCTCCCTTGGGGG + Intronic
1026478968 7:70762716-70762738 CCTTGTCTCCACCACCTGCGGGG - Intronic
1028985343 7:97005040-97005062 CCTGGGCTCCACCCCACTGGGGG - Intergenic
1035482922 7:159201943-159201965 CCTTGACTCCACACCCTTTGGGG - Intergenic
1037170407 8:15885466-15885488 CAGTGTCTCCACCCCGTTCAAGG - Intergenic
1047489784 8:125365052-125365074 GCTTGTTTCCACCCCTTTGTGGG + Intronic
1049765345 8:144352785-144352807 TCTTGTGCCCACCCCCTTGGAGG + Intronic
1050425741 9:5510889-5510911 CCTTCTCTCCACACCATTTGAGG + Intronic
1051663434 9:19446223-19446245 CCTTGTCTCCACCTCCTTGCTGG - Intronic
1051860661 9:21622052-21622074 CCTGGTCTCTAGCCTGTTGGTGG + Intergenic
1053222492 9:36323978-36324000 CCTTCTCTCCAGACCTTTGGAGG + Intergenic
1053384964 9:37679811-37679833 CCTTGTCTCCACCCTGGTGCAGG - Intronic
1057059729 9:91992878-91992900 CCATGTCTCCTCCCCGCAGGTGG - Intergenic
1203363152 Un_KI270442v1:235438-235460 CCCTGACTCCACCGCCTTGGAGG - Intergenic
1186076075 X:5880660-5880682 CCTTGTTTCCGTCCCGTAGGAGG - Intronic
1190912825 X:54788284-54788306 CCAGGTCTCCAACCCTTTGGGGG + Intronic
1190918129 X:54825092-54825114 CCAGGTCTCCAACCCTTTGGGGG - Intergenic
1198411008 X:136368105-136368127 CGTTTTCTCCACCGTGTTGGGGG - Intronic
1200084334 X:153595960-153595982 CCTGATCTCCACCCGGTGGGGGG - Intronic
1201075172 Y:10181350-10181372 CCCTGACTCCACCGCCTTGGAGG + Intergenic