ID: 948400763

View in Genome Browser
Species Human (GRCh38)
Location 2:237683237-237683259
Sequence CTAAAATCAAGCCGACGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948400758_948400763 25 Left 948400758 2:237683189-237683211 CCAACGGGGTGGAGACAAGGGGC 0: 1
1: 0
2: 2
3: 6
4: 117
Right 948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
948400754_948400763 28 Left 948400754 2:237683186-237683208 CCACCAACGGGGTGGAGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948400763 Original CRISPR CTAAAATCAAGCCGACGGTC AGG Intronic
912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG + Intergenic
923082806 1:230675132-230675154 CAAGAATCAAGACGACGGGCGGG - Intronic
1064676398 10:17764620-17764642 CTAAGATCAAGCTGACGGCAAGG + Intronic
1069409323 10:68136390-68136412 CTAAAAACATGCCACCGGTCAGG + Intronic
1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG + Intronic
1080403862 11:31961224-31961246 CTAAAATCAAGGTGTCGGCCGGG + Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG + Intronic
1112715708 13:102182350-102182372 CTAAAATCAAGGCGTCGGCAGGG - Intronic
1120188105 14:81415473-81415495 CTAACATCTAGCAGAGGGTCAGG - Intronic
1122380262 14:101298696-101298718 CAAAAATCAAGCTGAAGCTCAGG + Intergenic
1149488557 17:57064951-57064973 CTAAAATCAAGATGGTGGTCAGG + Intergenic
1158214050 18:55080715-55080737 CCAAAATCAAGGTGACGGTAGGG + Intergenic
1165817591 19:38651614-38651636 CAAAAAAAAAGCCAACGGTCAGG - Intronic
1166722874 19:45007560-45007582 CTAAAATCATGCCCATGGCCAGG + Intronic
927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG + Intergenic
929491173 2:42397925-42397947 TTAAAATCAAGAAGACGGGCTGG + Intronic
941396873 2:164984108-164984130 CTAAAATCAAGGTGACAGTAGGG + Intergenic
947736256 2:232456976-232456998 CTGCACTCAAGCCGATGGTCTGG - Exonic
948026599 2:234782926-234782948 CTAAAATCAAGGTGTCGGCCCGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948647126 2:239412373-239412395 CTGAAATCAAGGCGTCGGTCAGG + Intergenic
1169103565 20:2974247-2974269 CAAAAATCAAACAGACGGCCGGG - Intronic
1173352416 20:42257199-42257221 CTAAAATCAAGCTGCAGTTCTGG - Intronic
1179932969 21:44583157-44583179 CTTAAATCAAGCAGACACTCTGG + Intronic
1179941763 21:44644121-44644143 CTTAAATCAAGCAGACACTCTGG - Intronic
955212172 3:56952400-56952422 CTGAAATCAAGCTGTCAGTCAGG - Intronic
970849467 4:20583868-20583890 CTAAAATGAAGCAGAAGGTAAGG + Intronic
979674976 4:123399655-123399677 CCCAAAGCAAGCCCACGGTCTGG - Intronic
995154736 5:108897225-108897247 ATAAAATCAAGGTGACAGTCTGG - Intronic
997704685 5:135937493-135937515 TTGAAATCAAGCCCAAGGTCTGG - Intronic
1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG + Intronic
1023754195 7:43400826-43400848 CTAAAATCAAGCTGTCAGCCAGG + Intronic
1025173458 7:56782483-56782505 TGAAAATCAAGTCCACGGTCGGG - Intergenic
1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG + Intergenic
1026915310 7:74116501-74116523 CTGAAATCAAGACGCCGGTAGGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1187665381 X:21602983-21603005 CTAAAATCAAGATGAAGCTCAGG - Intronic
1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG + Intronic
1198377352 X:136052976-136052998 CTAAAATCAAGGGGACGGTGGGG - Intergenic