ID: 948400763 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:237683237-237683259 |
Sequence | CTAAAATCAAGCCGACGGTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 40 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 34} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948400758_948400763 | 25 | Left | 948400758 | 2:237683189-237683211 | CCAACGGGGTGGAGACAAGGGGC | 0: 1 1: 0 2: 2 3: 6 4: 117 |
||
Right | 948400763 | 2:237683237-237683259 | CTAAAATCAAGCCGACGGTCAGG | 0: 1 1: 0 2: 0 3: 5 4: 34 |
||||
948400754_948400763 | 28 | Left | 948400754 | 2:237683186-237683208 | CCACCAACGGGGTGGAGACAAGG | 0: 1 1: 0 2: 0 3: 6 4: 92 |
||
Right | 948400763 | 2:237683237-237683259 | CTAAAATCAAGCCGACGGTCAGG | 0: 1 1: 0 2: 0 3: 5 4: 34 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948400763 | Original CRISPR | CTAAAATCAAGCCGACGGTC AGG | Intronic | ||