ID: 948400763

View in Genome Browser
Species Human (GRCh38)
Location 2:237683237-237683259
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948400758_948400763 25 Left 948400758 2:237683189-237683211 CCAACGGGGTGGAGACAAGGGGC 0: 1
1: 0
2: 2
3: 6
4: 117
Right 948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
948400754_948400763 28 Left 948400754 2:237683186-237683208 CCACCAACGGGGTGGAGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type