ID: 948402396

View in Genome Browser
Species Human (GRCh38)
Location 2:237693073-237693095
Sequence CTGCATATTGAGCTGGACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948402396_948402401 -9 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402401 2:237693087-237693109 AATATGCAGTCGTGGGGCTACGG 0: 1
1: 0
2: 0
3: 5
4: 72
948402396_948402409 30 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402409 2:237693126-237693148 AAATTGGGCAGGGGATGAGGCGG 0: 1
1: 0
2: 3
3: 48
4: 539
948402396_948402405 19 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402405 2:237693115-237693137 GTTTGGCATTAAAATTGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
948402396_948402407 21 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402407 2:237693117-237693139 TTGGCATTAAAATTGGGCAGGGG 0: 1
1: 0
2: 0
3: 22
4: 229
948402396_948402402 2 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402402 2:237693098-237693120 GTGGGGCTACGGCTGTAGTTTGG 0: 1
1: 0
2: 1
3: 1
4: 71
948402396_948402408 27 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402408 2:237693123-237693145 TTAAAATTGGGCAGGGGATGAGG 0: 1
1: 0
2: 3
3: 36
4: 471
948402396_948402406 20 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402406 2:237693116-237693138 TTTGGCATTAAAATTGGGCAGGG 0: 1
1: 0
2: 5
3: 43
4: 469
948402396_948402404 15 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402404 2:237693111-237693133 TGTAGTTTGGCATTAAAATTGGG 0: 1
1: 0
2: 2
3: 28
4: 271
948402396_948402403 14 Left 948402396 2:237693073-237693095 CCGTTGTCCAGCTCAATATGCAG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 948402403 2:237693110-237693132 CTGTAGTTTGGCATTAAAATTGG 0: 1
1: 0
2: 1
3: 14
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948402396 Original CRISPR CTGCATATTGAGCTGGACAA CGG (reversed) Intronic
901668978 1:10843067-10843089 CTGCATGGGGACCTGGACAAGGG - Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
904922549 1:34020342-34020364 CTGCAAATATAGCTGGATAAAGG + Intronic
907525282 1:55050320-55050342 CTAGATATTGAGCTGGGCTATGG - Intronic
907741215 1:57167880-57167902 CTGGATATTTTGCTGGACACTGG - Intronic
910979030 1:92940020-92940042 CTGTATATTAAGCTGGCTAATGG + Intronic
912013642 1:105004882-105004904 CTGCATCTGCATCTGGACAAGGG + Intergenic
913283631 1:117208525-117208547 CTGAATATTGCACTAGACAATGG - Intronic
913811634 1:122897445-122897467 CTTCATATTCTGCTGGACAGAGG + Intergenic
915065101 1:153218381-153218403 CTGCACACTGAGGTGGACACTGG - Exonic
915216935 1:154346614-154346636 CTGCAGATTGGGCTCGACACAGG + Exonic
915670077 1:157481505-157481527 CTGCACATTGAACTGGACTTTGG + Intergenic
918021125 1:180692125-180692147 CTACATTTTCAGCTGGGCAAAGG + Intronic
918377707 1:183925705-183925727 CTGCATACTGGGGTGGAAAATGG + Intronic
919194077 1:194261084-194261106 CTGCATATTGAATTGGACATAGG + Intergenic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1064514811 10:16135308-16135330 CTGTATCTTGATCTGGACAACGG + Intergenic
1067452356 10:46390136-46390158 CTGCATACAGAGCTGGGAAATGG - Intronic
1067584878 10:47469619-47469641 CTGCATACAGAGCTGGGAAATGG + Intronic
1067907906 10:50313141-50313163 CTGCATATTGAGCTAAACGAAGG + Intronic
1068683597 10:59846262-59846284 CTGCCTGTTCATCTGGACAAAGG - Intronic
1070784947 10:79157532-79157554 CTGGACATTGAGCTGGACATTGG - Intronic
1074191025 10:111137719-111137741 ATGAATAGTGAGCTGGGCAAGGG - Intergenic
1076009396 10:126975306-126975328 CTGCAGAGTGAGATGGACATGGG - Intronic
1077592264 11:3501246-3501268 CTGCATTCTGACCTGGACAATGG + Intergenic
1077979191 11:7282457-7282479 CTCCATATTTACCTGGGCAAAGG - Intronic
1080894623 11:36439097-36439119 CTGCATTTGTAGGTGGACAAAGG + Intronic
1081071463 11:38615470-38615492 CTGCTTATGGATCTGGGCAAAGG - Intergenic
1084824723 11:71721503-71721525 CTGCATTCTGACCTGGACGATGG - Intergenic
1100380743 12:94059512-94059534 CTGAATATTGTGCTGCAAAAGGG - Intergenic
1101060867 12:100970544-100970566 CTACATACTCATCTGGACAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1109443257 13:62401334-62401356 CTGCCTGTTGACCTGAACAAGGG + Intergenic
1111151203 13:84255586-84255608 CATCATATAGAGCTTGACAATGG + Intergenic
1113507453 13:110827016-110827038 CTGGACAATGAGCTGGACACTGG - Intergenic
1113792104 13:113034472-113034494 CTGCTTATTGGGCTGCACGATGG + Intronic
1114420551 14:22578722-22578744 CTGCATCTTGATCTGGATAGTGG + Intronic
1115329440 14:32179588-32179610 CAGGACATTGAACTGGACAAAGG - Intergenic
1117018849 14:51548914-51548936 CTGCATTTTAACCTGGACCAAGG + Intronic
1117413008 14:55467869-55467891 CAGCATCTGGATCTGGACAAAGG + Intergenic
1118241550 14:64064291-64064313 CAGCATGATGTGCTGGACAAAGG + Intronic
1120428053 14:84375874-84375896 ATGCATATTGTGCTGGAAGAAGG - Intergenic
1121227055 14:92328761-92328783 TTGCAGATTGATCTGGCCAAGGG + Intronic
1121414260 14:93768174-93768196 CTGAACATTGAGGTGGAAAAAGG - Intronic
1121731630 14:96191496-96191518 CTGCATAGTGAGCTGGGCCCAGG + Intergenic
1126407845 15:48340088-48340110 CTGCCCATTGAGCTGAACACAGG + Intronic
1127291012 15:57571193-57571215 TAGCATATAGAGCTGGACAAAGG + Intergenic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131554037 15:93381068-93381090 CTGCATATTTAGGTGTACAGGGG + Intergenic
1135259688 16:20970122-20970144 CTGCCGCTGGAGCTGGACAATGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1142625781 17:1191017-1191039 CTGCAGATTGCGCTGGGCCATGG + Intronic
1143726352 17:8849556-8849578 CTGGACACTGAGCTTGACAATGG - Intronic
1143960702 17:10716048-10716070 CTGAATATTGATGTGGACATGGG - Intronic
1147043244 17:37733953-37733975 CTGCATGTGGAGCTGGAGATGGG + Intronic
1147634594 17:41955847-41955869 CTGCATTCTGACCTGGCCAACGG - Intronic
1148960038 17:51385181-51385203 CTGCGTAGTAAGCTGGACAGGGG + Intergenic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1166212122 19:41313477-41313499 CTGAAGACTGAGCTGGACAAGGG - Intronic
925455869 2:4016141-4016163 CTGCCTATTGAGCTGGAACCTGG - Intergenic
925769441 2:7267778-7267800 GAGCATACTGAGCTGAACAAAGG - Intergenic
931526514 2:63161211-63161233 CTGAAAATGGAGCTAGACAAGGG - Intronic
935796618 2:106647905-106647927 CTGCATATGTAGCTGGACATAGG - Intergenic
936805745 2:116330140-116330162 CTGCATAATGACTTGGTCAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938119846 2:128625682-128625704 CTGCCTGTTCAGCTGGACACTGG - Intergenic
938315194 2:130320339-130320361 CTGTACATTGAGCTGGACATGGG - Intergenic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
942513569 2:176728266-176728288 CTGCAGATGGAGCTGGTCCACGG - Intergenic
944291889 2:198017389-198017411 CTGCAGATTTAACTGGACAAAGG - Intronic
944441453 2:199747764-199747786 GTGCAGAATGAGCTGGAAAATGG - Intergenic
945017196 2:205531325-205531347 GATCTTATTGAGCTGGACAAAGG + Intronic
945204534 2:207318201-207318223 CCACATAAAGAGCTGGACAAGGG + Intergenic
948402396 2:237693073-237693095 CTGCATATTGAGCTGGACAACGG - Intronic
948761141 2:240191768-240191790 CTTCACATTGACCTGGGCAAAGG - Intergenic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1170036338 20:11993967-11993989 TTGCATATTGAGCTTGCCCAGGG + Intergenic
1171030018 20:21668919-21668941 CTCCCTATGGAGCTGGCCAAGGG - Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1172602097 20:36190870-36190892 CTGCAGAATGAGCAGGAAAATGG + Intronic
1173330526 20:42072543-42072565 CTGCACATTGAGCTAGTAAAAGG - Intergenic
1174745130 20:53054390-53054412 CTGCTAAATGAGCTTGACAATGG - Intronic
1175729023 20:61340359-61340381 CTGCATTATGTGCTGGACAGCGG - Intronic
1178110077 21:29361072-29361094 CTGCATCTCAAGCAGGACAATGG + Intronic
1182111186 22:27724945-27724967 CAGCAAATGGTGCTGGACAAAGG - Intergenic
949814028 3:8039557-8039579 CTCCATGTTGAGGTGCACAACGG + Intergenic
950563570 3:13750260-13750282 CAGCATATTGAGCTCCAAAATGG - Intergenic
953666101 3:44927714-44927736 CTTCAGATGGAGCTGGTCAAAGG + Intronic
955126199 3:56115151-56115173 ATGCATGTGGAGCTGGCCAAAGG - Intronic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
961156524 3:124684375-124684397 CTTTTTATTGAGCTGGAAAATGG - Intronic
961385351 3:126520184-126520206 GTGCATAGTGAGCTGGGCAGGGG - Intergenic
962061721 3:131934898-131934920 GTCCATATTGTGCTGGAAAAAGG + Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
965133254 3:164728201-164728223 CTGAATATTGACCTGGATAGTGG - Intergenic
974690887 4:65296858-65296880 CTGCATAATGATGTAGACAATGG + Intergenic
978845982 4:113273243-113273265 CTTAATATTGACCTGGAAAATGG + Intronic
979888304 4:126059937-126059959 CTGCATTTTCAGTTGTACAAAGG - Intergenic
980078068 4:128314866-128314888 CTGCATTCTGAGCTGGAGGAGGG - Intergenic
981328102 4:143475704-143475726 ATGGAGATTGAGCTGGACAATGG + Intergenic
983210367 4:164952253-164952275 CTGCATATTGGGCTGATCATTGG - Intergenic
986659676 5:10047780-10047802 CTGAATGATGAGCTGGATAATGG + Intergenic
991158892 5:63471586-63471608 TGGCATATTGAGCAAGACAAAGG - Intergenic
991230416 5:64326515-64326537 CTGCATATTCAGCTGGAGATTGG + Intronic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
992229536 5:74650504-74650526 CCGCAGATTGGGCTGGAGAAGGG + Intronic
994874211 5:105394019-105394041 CTGCACATTGATCTGGAGAAAGG + Intergenic
995353168 5:111205548-111205570 CTACATTTTGCCCTGGACAATGG - Intergenic
996572624 5:124948448-124948470 CCTCACATTGAGCTGGACACTGG + Intergenic
1012756435 6:103237921-103237943 GTGCATATAAAGCTGGGCAAGGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017240423 6:152162162-152162184 TTGCCTATTGAGCTGTAAAATGG - Intronic
1017941209 6:159054902-159054924 CTGGGTATTGAGTTGGAAAATGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1021170245 7:17390889-17390911 CTGCATTTTCTGGTGGACAAAGG - Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1026835423 7:73635950-73635972 CTGCATACTGAGCTGCACAAAGG - Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1033283130 7:140019695-140019717 CTGCCTTTTAAGCTGGACATAGG + Intronic
1035708870 8:1697363-1697385 CTGCAGATAGAGCATGACAACGG + Intronic
1039772533 8:40701806-40701828 CTGCATAGTGGGCTGGGCAGTGG - Intronic
1040852152 8:51912125-51912147 ATGGATATAGAGCTGTACAAAGG + Intergenic
1041367253 8:57120758-57120780 CTGAATATTTAGCAGGAAAAAGG - Intergenic
1047108747 8:121764933-121764955 CTTCATTCTGAGCTGGACATTGG + Intergenic
1047852692 8:128876065-128876087 CTGAATATTGTGCTTGAAAAGGG + Intergenic
1049862040 8:144905495-144905517 CTGCTTATTAAGATGGCCAATGG - Intergenic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051057222 9:13001805-13001827 CTGAATATTGACCTTGAGAAAGG - Intergenic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1053594261 9:39543972-39543994 CTGCATCTTTAGCTGAACTAAGG + Intergenic
1053852042 9:42299017-42299039 CTGCATCTTTAGCTGAACTAAGG + Intergenic
1054571992 9:66820986-66821008 CTGCATCTTTAGCTGAACTAAGG - Intergenic
1055725799 9:79227319-79227341 CTGCATATTTGGTTGGACATGGG + Intergenic
1055949607 9:81718709-81718731 CTGCACCTTGAGCTAGAAAAGGG - Intergenic
1056022752 9:82457746-82457768 CTGCATGTTGAGCTGGCTCAAGG - Intergenic
1058153924 9:101490724-101490746 CAGCCTATTGAGCTGGAAACTGG - Intronic
1059318882 9:113450817-113450839 CTGCATAATGAGGAAGACAATGG + Intronic
1186533374 X:10320282-10320304 CTGCATATTGAACTGATTAATGG - Intergenic
1187486840 X:19712094-19712116 CTGCATATTGAAATCGACTAGGG + Intronic
1189017102 X:37295827-37295849 CAGCATATTGAGCTGTACTTTGG + Intergenic