ID: 948403451

View in Genome Browser
Species Human (GRCh38)
Location 2:237701068-237701090
Sequence CTGAGCATTGAAGCTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948403451_948403457 18 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 245
948403451_948403454 -1 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403454 2:237701090-237701112 GGAAATGTATGAGCAGTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 210
948403451_948403459 20 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403459 2:237701111-237701133 GGATCCCCTGAAGGAGTGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 182
948403451_948403455 11 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403455 2:237701102-237701124 GCAGTGCCAGGATCCCCTGAAGG 0: 1
1: 0
2: 4
3: 25
4: 222
948403451_948403458 19 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403458 2:237701110-237701132 AGGATCCCCTGAAGGAGTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948403451 Original CRISPR CTGAGCATTGAAGCTTTTCT GGG (reversed) Intronic
904342674 1:29847150-29847172 CTGAGCAGAGATGCTTTCCTTGG + Intergenic
905455121 1:38083353-38083375 CTGAGCAGTGTGGCTTGTCTGGG + Intergenic
907360720 1:53912342-53912364 TTGAGCATTGATTCTTTTCTGGG + Intergenic
907777342 1:57530932-57530954 CTGAGCAGAGAATCTTTTGTTGG + Intronic
908383785 1:63621123-63621145 TTTAGAATAGAAGCTTTTCTAGG + Intronic
910447933 1:87317755-87317777 CTCAGCTTTGATGCTATTCTTGG + Intergenic
911953397 1:104205539-104205561 ATGAGCACTGAATCTTTTATGGG + Intergenic
916469789 1:165112011-165112033 CTGGGCATTAACGGTTTTCTTGG + Intergenic
919458193 1:197845208-197845230 ATGAACATTGCAGCATTTCTGGG - Intergenic
920761995 1:208793176-208793198 CTGAACATTGATGCTTTAGTCGG - Intergenic
921682722 1:218053362-218053384 TTCAGCATTTCAGCTTTTCTTGG - Intergenic
923965970 1:239139664-239139686 GTGAGCATTGAGGGTGTTCTTGG - Intergenic
924894517 1:248321466-248321488 ATGAGCCTTGAGGGTTTTCTAGG - Intergenic
1065690416 10:28326883-28326905 CTAAGCATTGAAGCTTTTTCTGG - Intronic
1065717753 10:28589761-28589783 CTGAGCATATTAGCTCTTCTGGG + Exonic
1067175783 10:43944412-43944434 TTGAACATTGAAGCTTGTCATGG - Intergenic
1075508694 10:123050827-123050849 ATGAACTTTGAAGTTTTTCTAGG + Intronic
1079224882 11:18596384-18596406 CTGACCACTGAAGCTTTTTGTGG - Intergenic
1080786973 11:35484359-35484381 CTGAGCATTGTTCTTTTTCTGGG + Intronic
1081135691 11:39437692-39437714 CTGAGAGTTGCAGCTGTTCTTGG - Intergenic
1082303402 11:50539829-50539851 CAGATCACAGAAGCTTTTCTCGG + Intergenic
1082577625 11:54828792-54828814 CACAGCATTGAAGCTTTCTTTGG + Intergenic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1090384754 11:126351037-126351059 CAGAACATTAAAGATTTTCTTGG - Intergenic
1092074731 12:5663604-5663626 CTGAGCATTTCAGCATTTCAGGG - Intronic
1093223105 12:16447280-16447302 CTAATCATTGAAGCTCTTTTGGG + Intronic
1095357333 12:41291353-41291375 GTGAGCATGGTAGCATTTCTTGG + Intronic
1096083762 12:48851529-48851551 CTGAGCCTTGATACTCTTCTTGG - Intronic
1097366718 12:58722938-58722960 ATGAGCATTTTAGCTTGTCTGGG - Intronic
1097636026 12:62122985-62123007 ATCACCCTTGAAGCTTTTCTAGG + Intronic
1099565429 12:84237796-84237818 CTGATAATTAAAGATTTTCTTGG - Intergenic
1104476419 12:129074130-129074152 CTGCCCATTGATGCTTTTTTGGG + Exonic
1107663157 13:42660417-42660439 CAGAGTATTAAAGCTTTTATTGG - Intergenic
1108126616 13:47251668-47251690 CAGAGCATTGAAGATTTTTAAGG + Intergenic
1111517664 13:89356531-89356553 TTGACCATTGAAGCTTTTGGTGG + Intergenic
1114930854 14:27466075-27466097 CTGAGCATTCAAGCTCACCTTGG + Intergenic
1117433346 14:55692836-55692858 CTGAGGATAGGAGCTTTTCTAGG + Intronic
1118084996 14:62404412-62404434 CAGAGCATTGAACTTTTCCTGGG - Intergenic
1119471140 14:74900176-74900198 CTGAGTAATGAAGGTATTCTAGG + Intronic
1119736386 14:76985391-76985413 CTGAGGCTTGAAAGTTTTCTTGG + Intergenic
1123587270 15:21771887-21771909 CTGAGCATTTCAGCATTTCAGGG + Intergenic
1123623908 15:22214452-22214474 CTGAGCATTTCAGCATTTCAGGG + Intergenic
1126961400 15:54000361-54000383 CTAAGCATTGTAACTATTCTTGG + Intergenic
1127466786 15:59251686-59251708 ATGAGCACTGAAGCATTTCAAGG - Intronic
1127657967 15:61073418-61073440 ATGGGCAGTGAAGCTTATCTAGG + Intronic
1128034382 15:64510880-64510902 CTGGGCATTAAATCCTTTCTTGG + Intronic
1128393784 15:67202359-67202381 CTGAGCTATGATGCTTTTATTGG - Exonic
1128894982 15:71364768-71364790 CTGAGCTTTAAAGCGTGTCTTGG + Intronic
1135423256 16:22318531-22318553 GTGAGCTTTGAAGCCTTTCCAGG + Intronic
1138309259 16:56009236-56009258 CCTAGTATTGAAGCTGTTCTCGG + Intergenic
1140546680 16:75816463-75816485 CTGAGCATTGATGTTTTACTTGG - Intergenic
1142281449 16:89150209-89150231 CTGAGCACTGAAGATATTTTTGG + Intronic
1144078602 17:11741794-11741816 CTAAGCCTTGAATCTATTCTAGG + Intronic
1144145340 17:12392517-12392539 GTGAGCATGGAAGCTTGACTTGG + Intergenic
1147260813 17:39209005-39209027 CTGAGCACAGCAGCTTTTTTGGG - Intergenic
1148244493 17:46021493-46021515 CTGAGCATTGGTGATTTCCTGGG + Intronic
1148845525 17:50527710-50527732 CAGAGAAATGAAGCTTTTATTGG - Intronic
1150543347 17:66127194-66127216 CTGAGAATTAAATCTTTCCTTGG - Intronic
1158697882 18:59718870-59718892 CTGAGCAGTGAAGAGTTTCAGGG - Intergenic
1159027365 18:63196379-63196401 ATTAGTATTGATGCTTTTCTTGG - Intronic
1160978067 19:1803517-1803539 CTGAGCAAGGAGGCTTTTGTGGG - Intronic
1161861885 19:6804092-6804114 CAGAGCATGGAAGCTTTCCACGG + Intronic
1162710903 19:12594011-12594033 CTGAACATTGAGGCTCTCCTGGG - Intronic
1164511389 19:28900043-28900065 CTGAGCATTGAAGATACGCTTGG + Intergenic
1168465661 19:56599091-56599113 GAGAGGATTGAGGCTTTTCTGGG + Intronic
925577155 2:5371864-5371886 CTGAGCATTGAAGCACTTGAAGG - Intergenic
925613647 2:5724855-5724877 CTAATCATTTAAGCTATTCTGGG + Intergenic
931101282 2:59004292-59004314 CATGTCATTGAAGCTTTTCTTGG + Intergenic
933506878 2:83187875-83187897 CTGAGCATTATAGCTTCTCTTGG - Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
941701211 2:168606061-168606083 GTGAGCACTGCAGCTTTTCCAGG - Intronic
942676107 2:178428273-178428295 CTGAGGATTGAAGATTTTTCAGG + Intergenic
942785433 2:179696092-179696114 CTTAGCATTGAAGGTGTTGTGGG + Intronic
944325382 2:198398260-198398282 CTGAGCATTCAAACTCATCTGGG - Intronic
944947578 2:204707451-204707473 CATAGTATTGAAACTTTTCTTGG + Intronic
945949180 2:216022607-216022629 CTGAGAATTGAGACTGTTCTGGG - Intronic
947812487 2:233013230-233013252 CTTACCAGTGAAGCTTTTCCAGG - Exonic
948403451 2:237701068-237701090 CTGAGCATTGAAGCTTTTCTGGG - Intronic
1169499816 20:6148391-6148413 CTGAGGGCTGAAGCTTTTGTTGG + Intergenic
1170121876 20:12921098-12921120 CTGAGAGTTGAAGCTTTTAATGG - Intergenic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1173676214 20:44838004-44838026 CAGAGCAGGGAAGCTTTTCCTGG - Intergenic
1174364090 20:50045953-50045975 CTGAAGATTGGAGCTTTCCTGGG + Intergenic
1177629545 21:23708831-23708853 CCGAGCATTTAAGCTGTGCTAGG - Intergenic
1180862858 22:19096989-19097011 TAGTGCATTGAAGTTTTTCTGGG - Intronic
1183248116 22:36709667-36709689 CTGAGCATTTATGCTGTTCCAGG - Intergenic
1184490783 22:44807573-44807595 CTGAGCAGTCAAGCATTCCTGGG + Intronic
949654708 3:6204654-6204676 CAGAGGAATGAAGCTTTTCATGG - Intergenic
949857440 3:8474864-8474886 CTTAGCATTTAACCATTTCTAGG - Intergenic
949874632 3:8618250-8618272 CTGAGCCTGGAAGGTTTGCTGGG + Intergenic
951364421 3:21763335-21763357 CTCAGCATTTTATCTTTTCTAGG + Intronic
951511838 3:23510923-23510945 CTGAGCCTTAATTCTTTTCTGGG - Intronic
953356556 3:42261055-42261077 TGTAGCATTGAAGCTTTGCTGGG + Intronic
955675717 3:61446759-61446781 CAGTGCACTGAAGCTTTTCATGG + Intergenic
955786503 3:62546333-62546355 CTCAGGATTGAAGCGTTTCCTGG + Intronic
956604520 3:71059786-71059808 CTGTGGATAGAATCTTTTCTGGG - Intronic
958577754 3:95974273-95974295 TTGAGTATTGCAGCTTTTCTAGG - Intergenic
958689477 3:97444905-97444927 CTGAGAATCAAGGCTTTTCTGGG - Intronic
958797405 3:98720305-98720327 CCGAGCACTGAAGATTTTTTTGG + Intergenic
960564585 3:119119691-119119713 CTGAGAATTGAAATTTTTCTGGG - Intronic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
960983334 3:123252799-123252821 CGTAGCACTGAAGTTTTTCTTGG + Intronic
967518681 3:190402142-190402164 CTGACAATTGAAGCCTTTCTGGG - Intronic
968016656 3:195341113-195341135 CTAAGCATTAAAGTTTTTTTAGG + Intronic
969358368 4:6645179-6645201 GAGAGCAATGAAGCTTTTCTGGG + Intergenic
970541195 4:17081587-17081609 CTGAGCCTTGAAGGGTGTCTAGG - Intergenic
970919060 4:21371253-21371275 CTGAGCTTTGAGGCATTTATGGG + Intronic
972667140 4:41177225-41177247 TACAGAATTGAAGCTTTTCTGGG + Intronic
973022911 4:45225728-45225750 CTCAGTATTGAATCTTCTCTCGG - Intergenic
973601811 4:52549628-52549650 CTGAGCATTCAGGCTAGTCTTGG + Intergenic
975267351 4:72386125-72386147 CTGAGTATGGAAGCTTTTCAAGG - Intronic
975660042 4:76679606-76679628 TTGAGGACTGAATCTTTTCTGGG - Intronic
976427689 4:84924969-84924991 GTGAGCATTAAACCTTTTGTAGG - Intronic
977447360 4:97147934-97147956 CAGAGCAGTGAAGCTCTTCTAGG - Intergenic
977687100 4:99859691-99859713 CTGAGCATTGAAGCATGACTGGG - Intronic
977755970 4:100672626-100672648 CAGAGCCATGAAGCTCTTCTAGG + Intronic
978941319 4:114439123-114439145 TTGCGCATTGCTGCTTTTCTTGG + Intergenic
979754927 4:124328417-124328439 CTGAAAATGGAAGCTTTTCTGGG + Intergenic
980719122 4:136670283-136670305 CTGAGAATTAAAGATTGTCTGGG + Intergenic
980965472 4:139516606-139516628 CTGCTCATTGAACCTCTTCTTGG - Intronic
982039551 4:151382797-151382819 CTGAGCATTGGTGCTTTTACAGG + Intergenic
982670056 4:158309847-158309869 CTGAGTCTTGAGGATTTTCTAGG + Intergenic
982868342 4:160545604-160545626 CTGTGCACTGAATCTCTTCTGGG + Intergenic
982965787 4:161905802-161905824 CTGAGCCTGGAAGCTTCTCTGGG + Intronic
983379142 4:166968858-166968880 TTGAGTGTTGCAGCTTTTCTAGG - Intronic
984436174 4:179713121-179713143 CAGACCTTTGAAGTTTTTCTTGG - Intergenic
986487611 5:8254878-8254900 CTGAGTACTGAATCTGTTCTGGG + Intergenic
987211455 5:15687889-15687911 CTAAGAATTGGAGCTTTTCGAGG + Intronic
988254677 5:28807211-28807233 ATGAAGATTGAAGCTATTCTAGG + Intergenic
990908834 5:60833367-60833389 CTGAGAATTGAAGCCTTTGCTGG - Intronic
991042847 5:62193582-62193604 CTGAGCACTGTGGCTTTTCCAGG - Intergenic
994341532 5:98635100-98635122 TTAAGCATTAAAGCTGTTCTTGG + Intergenic
994445368 5:99865209-99865231 CTGAAAATCAAAGCTTTTCTTGG - Intergenic
997922724 5:137998086-137998108 CTGAGCATTGGGGCTTTTATAGG - Intronic
999284556 5:150386479-150386501 CTGAGGGTGGAAGCTTCTCTGGG - Intronic
1001038633 5:168316034-168316056 CTGAGCATTCTAGCTGTCCTGGG - Intronic
1002308132 5:178296404-178296426 CTGGGCATGGTAGCCTTTCTGGG - Intronic
1003080087 6:3014740-3014762 CTGAGCATTGATTCTGTTTTGGG + Intronic
1006961933 6:37940469-37940491 CTAAGCACTGAAGCTTTTAAAGG - Intronic
1015993802 6:138977457-138977479 CATATCATTGAAGCTATTCTTGG - Intronic
1018263812 6:161998317-161998339 CTGAGAAATGAAGCGTTTCTTGG - Intronic
1018787620 6:167120597-167120619 CTCAACATTGAGGCATTTCTAGG - Intergenic
1019758597 7:2791670-2791692 CTGAGTGTCAAAGCTTTTCTAGG - Intronic
1020991218 7:15198711-15198733 AAGAGCCTTGAAGCTATTCTTGG + Intergenic
1023060131 7:36318659-36318681 CTGAGCTGAGAAGCTTCTCTTGG + Intergenic
1023735735 7:43234592-43234614 CTTATCTTTGAAGCTTTTCCTGG + Intronic
1025840577 7:65142007-65142029 CTGAGGACTGAAGCGATTCTTGG + Intergenic
1025878138 7:65508157-65508179 CTGAGGACTGAAGCGATTCTTGG - Intergenic
1025882475 7:65553952-65553974 CTGAGGACTGAAGCGATTCTTGG - Intergenic
1025890968 7:65648651-65648673 CTGAGGACTGAAGCGATTCTTGG + Intergenic
1029554883 7:101261769-101261791 GTGGGAATTGAAGCCTTTCTAGG + Intergenic
1030617569 7:111754335-111754357 CTCAGCATTGAAACTACTCTCGG - Intronic
1037286305 8:17304270-17304292 CTGATCTTTGAGGCTTTTATTGG - Intronic
1039009204 8:33074647-33074669 TTGAGAATAGAAGCTTTTTTGGG - Intergenic
1039046564 8:33455812-33455834 CTGATCATTGAAGCATTGCATGG + Intronic
1040920090 8:52606438-52606460 CTGAGCACTGAATCTTTTCTCGG + Intergenic
1044341617 8:91052560-91052582 CTGAGAAATGTAGCTTATCTGGG - Intergenic
1045772032 8:105753406-105753428 GTGATAATTGAAGCTGTTCTTGG + Intronic
1050754942 9:8990804-8990826 CTGAACAGAGAAGCCTTTCTGGG + Intronic
1053811805 9:41860799-41860821 CTTAGCATCTAAGTTTTTCTTGG + Intergenic
1054618790 9:67326640-67326662 CTTAGCATCTAAGTTTTTCTTGG - Intergenic
1057826055 9:98372615-98372637 CTGAGCACAGTAGCTTTGCTTGG + Intronic
1058500942 9:105615386-105615408 CTGAGCAGTGGAACTTGTCTAGG + Exonic
1059716744 9:116920245-116920267 CTGAGCCTGGAAGCTCTACTGGG - Intronic
1061925479 9:133804135-133804157 CTGAGTCCTGAAGCTTTTATAGG - Intronic
1187211389 X:17235832-17235854 CTGTGGTTTGAAGCATTTCTAGG - Intergenic
1190897921 X:54639585-54639607 TTGAGCTTTGCAGCTTTTCTTGG + Intergenic
1192917028 X:75663516-75663538 CTGAGCCTTTAGGGTTTTCTAGG + Intergenic
1193636727 X:83959575-83959597 ATGAGTCTTTAAGCTTTTCTAGG - Intergenic
1196847228 X:119905786-119905808 CTGCTCATTGAGGCTTTTCTTGG + Intronic
1199597652 X:149519959-149519981 CTGAGTCTTTAAGGTTTTCTAGG - Intronic