ID: 948403457

View in Genome Browser
Species Human (GRCh38)
Location 2:237701109-237701131
Sequence CAGGATCCCCTGAAGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948403451_948403457 18 Left 948403451 2:237701068-237701090 CCCAGAAAAGCTTCAATGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 245
948403452_948403457 17 Left 948403452 2:237701069-237701091 CCAGAAAAGCTTCAATGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 136
Right 948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948403457 Original CRISPR CAGGATCCCCTGAAGGAGTG TGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900417745 1:2542894-2542916 CAGCATCCCCTGTAAGAGTTGGG - Intergenic
901678926 1:10902062-10902084 CAAGAGCCCCCGAAGGAGTCAGG - Intergenic
902774662 1:18666949-18666971 CAGGATAGGCTGAGGGAGTGGGG + Intronic
903092374 1:20933133-20933155 CAGGATGCTGTGAAGGATTGGGG - Intronic
903180562 1:21602970-21602992 CAGGATCCCCAGAGGGGATGTGG - Intronic
904954398 1:34270984-34271006 CAGGTCCTCCTCAAGGAGTGTGG + Intergenic
905106437 1:35565971-35565993 CTGGCTCCCCTGCAGGAGGGAGG + Exonic
905415928 1:37804190-37804212 TATGTTGCCCTGAAGGAGTGTGG - Intronic
905515265 1:38558025-38558047 CAGAGTCCCCTGAAGAAGGGTGG - Intergenic
906241161 1:44243082-44243104 TGGTCTCCCCTGAAGGAGTGGGG - Intronic
906301847 1:44688157-44688179 CAGGATCCCATGAGGGGGTTTGG + Intronic
909742710 1:79051438-79051460 CAGAATCCCCTGCAGGAATTTGG + Intergenic
912318824 1:108691900-108691922 CAGAATCTCCTGGAGGAGTGGGG + Intergenic
912989641 1:114472638-114472660 GAGGATCACCTGAGGGTGTGAGG + Intronic
913122778 1:115756908-115756930 CAGGCTCCCCGGCTGGAGTGCGG - Intronic
913670648 1:121094713-121094735 CAGATTCCCCTCCAGGAGTGGGG - Intronic
914660896 1:149790093-149790115 CAGATTCCCCTCCAGGAGTGGGG - Exonic
914825538 1:151136139-151136161 CAGGATCCTGTGCAGGAGTAGGG - Exonic
915242662 1:154534543-154534565 AACTATCCGCTGAAGGAGTGGGG + Intronic
915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG + Exonic
915668205 1:157463991-157464013 CAGCATCCCCCTATGGAGTGTGG - Intergenic
916951234 1:169782336-169782358 CGGGATAACTTGAAGGAGTGGGG - Intronic
917749421 1:178040739-178040761 GTGGATCTCCTCAAGGAGTGAGG - Intergenic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
920164579 1:204026508-204026530 CAGGGACCCCGGATGGAGTGAGG + Intergenic
920419695 1:205824251-205824273 CTGGATGCCCTGAAGGTTTGTGG + Intergenic
920438271 1:205962053-205962075 CAGGATGCCAGGAGGGAGTGTGG + Intergenic
921195962 1:212757946-212757968 CAGGATCTACTGATGGACTGAGG + Intronic
921304593 1:213783075-213783097 CACGTTCCCCTGAAAGGGTGGGG - Intergenic
922605119 1:226885401-226885423 CATGCTGCCCTGATGGAGTGCGG - Intronic
923606850 1:235451989-235452011 CAGAATCCACTGATTGAGTGTGG - Intronic
1062906975 10:1185951-1185973 CAGGAGCACCTCAAGGAGTCAGG - Intronic
1063233130 10:4085782-4085804 CAATATTCCCTGAAGGACTGTGG + Intergenic
1065575919 10:27118082-27118104 CAGTATCCACTGAAGGGGTGGGG - Intronic
1065628446 10:27654144-27654166 CAGCTTCCCCTGAAGCAGAGAGG + Intergenic
1069708785 10:70476121-70476143 CAGGATCTCAGGAAGGAGAGAGG - Intergenic
1069813246 10:71178009-71178031 CAGGAGTCCTTCAAGGAGTGAGG + Intergenic
1071487746 10:86114084-86114106 CATAACCCCCTGAAGGAGGGTGG + Intronic
1072434560 10:95403358-95403380 CAGGAGCTCCTGAAAGAGAGAGG - Intronic
1073320195 10:102611445-102611467 CAGGGTCCACTCAAGGAGTCAGG + Intronic
1074032300 10:109700972-109700994 CAGTCTCCCATTAAGGAGTGAGG - Intergenic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1077517784 11:3012217-3012239 CAGAATTCCGAGAAGGAGTGCGG - Exonic
1078773139 11:14369550-14369572 CAGGATCCCTGGAGAGAGTGTGG + Intergenic
1082190967 11:49244458-49244480 AAGGCTTCCCTGAAGGAGTGAGG + Intergenic
1082830928 11:57616649-57616671 CAGGATCTCCCCAAGGAGAGGGG - Intergenic
1083225252 11:61280931-61280953 CACCTCCCCCTGAAGGAGTGAGG + Exonic
1083546516 11:63552994-63553016 CAGGATCCCCACAAGGCTTGCGG + Exonic
1085319809 11:75567011-75567033 CAGGACCCCCTGCAAGAGTTAGG + Intronic
1085569963 11:77550677-77550699 GTGGATCTCCTCAAGGAGTGAGG - Intronic
1085781044 11:79409532-79409554 CAGGTTCCCATGAAGGAGGGTGG + Intronic
1086675149 11:89596562-89596584 AAGGCTTCCCTAAAGGAGTGAGG - Intergenic
1087092251 11:94285664-94285686 GAGTATCCCATGAAAGAGTGGGG + Intergenic
1087694570 11:101361887-101361909 CACAATCCACTGAGGGAGTGGGG - Intergenic
1088923141 11:114276267-114276289 CAGGAGCCCCTGCAGGAGACAGG + Intronic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1090789894 11:130082798-130082820 CAGCATCCCCAGAAAGAGAGAGG + Intronic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1092159643 12:6309267-6309289 CAGGATGCTCTGAAGAAGTAAGG + Intergenic
1092205384 12:6611665-6611687 CTGGATCCCCTGGAGAAATGAGG - Intergenic
1093280908 12:17195263-17195285 CAGGGTCCCCTGAGGGTTTGGGG + Intergenic
1095287870 12:40437596-40437618 CAGGGCCCCCTTAAGGAGTTTGG - Intronic
1096088609 12:48883386-48883408 AAGGATACCCTGAGGGGGTGAGG - Intergenic
1096243630 12:49972668-49972690 CAGGACCCCCTGAAGCAGGCCGG + Intronic
1096496325 12:52041411-52041433 CTGGAGCCCCTTAAGGAGAGTGG + Intronic
1098991383 12:77067707-77067729 CAAGAGCCCCAGAGGGAGTGTGG - Intergenic
1099810794 12:87579727-87579749 CAGGATTTCCTGATGGATTGGGG + Intergenic
1100119352 12:91350603-91350625 TGGGATCATCTGAAGGAGTGAGG - Intergenic
1104596114 12:130120782-130120804 CTGGATCCCCTGGGGGACTGGGG + Intergenic
1109219494 13:59627069-59627091 CAGGATCCCATGAAGGCACGTGG - Intergenic
1110473106 13:75882759-75882781 CAGGATGTCCAGAATGAGTGTGG + Intronic
1110507110 13:76299587-76299609 CAGGCTCTCCTTAAGGTGTGAGG + Intergenic
1114483104 14:23047469-23047491 CAACATCCCCTGCAGGAGGGTGG + Exonic
1115548102 14:34481203-34481225 TGGAATCCCCTGAAGGGGTGAGG - Intergenic
1122451180 14:101808889-101808911 CAGGATCCCATGAGGGGGTGCGG - Intronic
1122546335 14:102524701-102524723 CAGGAGTCCCTGCAGGAGTTGGG + Intergenic
1122651323 14:103228708-103228730 CAGGAGCCACTGCAGGAGTCAGG + Intergenic
1122817675 14:104321543-104321565 AAGGCTCCCCAGAAGGAGTCTGG + Intergenic
1124141311 15:27079607-27079629 CAAGAACCCCTGAAGGAGTCTGG + Intronic
1124398715 15:29329955-29329977 CAGCCTCCACTTAAGGAGTGGGG - Intronic
1126950159 15:53871999-53872021 CAGGTTCTCCTGAAGAAGGGAGG - Intergenic
1129060497 15:72856904-72856926 CAGGAGCCCCTGGTGGAGGGAGG - Intergenic
1129516025 15:76158146-76158168 CAGGATCCCATAAAGGAATTGGG - Intronic
1131151304 15:90049012-90049034 CTAAATCCCATGAAGGAGTGGGG - Intronic
1131324099 15:91425902-91425924 CAGGATCCCCTGAATTATTTGGG + Intergenic
1135293776 16:21262056-21262078 GAGGCTGCCCTGAAGGAGTCTGG - Exonic
1136048674 16:27635365-27635387 AAGGCTCCCCAGGAGGAGTGTGG + Intronic
1138206679 16:55130620-55130642 CAGGGTCCCCGGGAGAAGTGAGG - Intergenic
1138343528 16:56306395-56306417 GAGGAAACCCTGAAGGAGCGGGG - Intronic
1139530369 16:67539714-67539736 CAGGAAGCCCTGCAGGGGTGGGG - Exonic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1141199021 16:81882969-81882991 GAGGAGCCCCTCCAGGAGTGTGG - Intronic
1143870309 17:9953440-9953462 AGGGCTCCCCTGCAGGAGTGAGG - Intronic
1144129624 17:12233662-12233684 CAGCTTCCTCTGATGGAGTGAGG - Intergenic
1144285748 17:13772325-13772347 CAAGATCACCTGTAGGAGAGTGG + Intergenic
1144421575 17:15103900-15103922 CAGGATTCCCTTGAGGGGTGTGG - Intergenic
1144563812 17:16343708-16343730 CAGGAGGCCCTGAAGCAATGGGG + Intronic
1144759931 17:17701409-17701431 CAGGATCACTTGATGGGGTGGGG - Intronic
1144813686 17:18018547-18018569 CACAAGCTCCTGAAGGAGTGAGG - Exonic
1148824545 17:50382798-50382820 CAGGGTTCCCTGAAGGAATGAGG - Exonic
1150132033 17:62674598-62674620 CTGTCTCCCCTGGAGGAGTGAGG + Intronic
1150602975 17:66666501-66666523 CAAAGTCCCCTGAAGGAGAGAGG - Intronic
1151216876 17:72583115-72583137 CTGGATCCCCTAAAGAAGTCTGG + Intergenic
1152065312 17:78109315-78109337 GAAGATCCTCTGCAGGAGTGCGG + Intergenic
1152271828 17:79329376-79329398 CAGGATCACCGGCAGGAGTGTGG - Intronic
1152832209 17:82504334-82504356 CAGGAGCTCCTGAAGGTCTGCGG + Intergenic
1153969874 18:10216266-10216288 AAAGATCCCCTGGAGGAGTCCGG + Intergenic
1154080146 18:11248261-11248283 CCGGTTCCCCTGAAGGCCTGAGG + Intergenic
1158299628 18:56036789-56036811 CAGGCTCCCCTGAAGAACAGAGG - Intergenic
1158576980 18:58646255-58646277 GTGGATCTCCTTAAGGAGTGAGG + Intergenic
1159948479 18:74461075-74461097 AAGGATCCCCAGAAGGACTCGGG + Intergenic
1160342627 18:78102490-78102512 CAGGATGACCTGAAGGCGGGGGG + Intergenic
1160785882 19:900138-900160 CGGGGTCCTCTGCAGGAGTGGGG + Exonic
1162406759 19:10479492-10479514 CAGGGTCCCCTCAAGAAGGGCGG - Intergenic
1163142825 19:15362036-15362058 CCGGATCCCTTGAAGGAGGAAGG - Intronic
1166040263 19:40198166-40198188 CAGGCTCCCATGAGGGAGTAGGG - Intronic
1166377768 19:42337192-42337214 CAGGAACCCCTGAGGGTGAGTGG + Exonic
1166752164 19:45169494-45169516 CAGGATCCTCACAAGGAGTAAGG + Intronic
1167528637 19:50001132-50001154 CAGAATCCCCTAAGTGAGTGGGG + Intronic
1167748933 19:51368403-51368425 CAGCATCCCCTGCCAGAGTGAGG - Exonic
1168325558 19:55536933-55536955 CAGGCTCCCCTGAGGGACCGAGG + Intronic
925058920 2:876183-876205 CGGGATGGCCTGAGGGAGTGGGG + Intergenic
925289970 2:2740842-2740864 AAGGAGCACCTGTAGGAGTGAGG + Intergenic
926881018 2:17543347-17543369 CTGGATTCCCTGAAGGATTTTGG - Intronic
929788204 2:45006814-45006836 CAGGGTTCCCTGAAGTTGTGGGG + Intronic
930719787 2:54627952-54627974 CATCTTCCCCTGAAGGTGTGGGG + Intronic
931897068 2:66744168-66744190 CAGTATGCCCTGTAGCAGTGAGG - Intergenic
933296913 2:80501678-80501700 GAGGAACCCCTAAGGGAGTGGGG + Intronic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
937319961 2:120955250-120955272 CAGGAGCACCTTAAGGAGAGGGG + Exonic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
939000511 2:136728539-136728561 CAAGATCCATTAAAGGAGTGAGG - Intergenic
939072789 2:137563554-137563576 CAGGATACGCTAAAGGATTGTGG - Intronic
940009157 2:149037110-149037132 CAGAACCCACTGAAGGGGTGGGG + Intergenic
941656115 2:168146521-168146543 CAGGGTCCCCTGAAGCTATGGGG - Intronic
945283731 2:208061526-208061548 CAGGTTCCCCAAAAGGAGTTTGG - Intergenic
946153760 2:217793770-217793792 CAGAATCCCCTGAGGGAGGGAGG + Intergenic
947167004 2:227272972-227272994 CAGGATCCCCTGGAGGACCTTGG - Exonic
947767028 2:232644382-232644404 CAGGAGCCACTAAAGGAATGAGG - Intronic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
948553869 2:238794246-238794268 CAGAATCCCCGGGAGGAGGGGGG + Intergenic
949072535 2:242034442-242034464 CAGCCTCCCCTGCAGGAGTGAGG + Intergenic
1172296587 20:33815586-33815608 CAGCATCCCCTGAAACTGTGAGG + Intronic
1172441885 20:34971690-34971712 GAGGATGCACTGAAGGGGTGAGG - Intergenic
1172648968 20:36489757-36489779 GAGGATCCCCAGAAGGACTTGGG + Intronic
1172835484 20:37870419-37870441 CAGAATCCCCGCAAGGACTGGGG - Intronic
1173845655 20:46186806-46186828 CAGGTACCCCTGAGGGGGTGGGG - Exonic
1174435868 20:50506385-50506407 CAGCACCCCCTGCAGGCGTGAGG + Intergenic
1175517794 20:59579818-59579840 CAGGATGCCCTGTAGGTTTGGGG + Intronic
1178788689 21:35677812-35677834 CAGAGTCCCCTGAGGGAGTGAGG + Intronic
1178955812 21:37020815-37020837 AAGCATCACATGAAGGAGTGAGG - Intergenic
1179594250 21:42431334-42431356 CAGGCTCCCCAGAAAGAGGGCGG + Intronic
1179708186 21:43194458-43194480 CTGGGCCACCTGAAGGAGTGGGG + Intergenic
1181037605 22:20177465-20177487 CAGGACCCCCTCAGCGAGTGCGG + Intergenic
1181408738 22:22703343-22703365 CAGCATCTCCTGAAGGAGGCTGG - Intergenic
1181601879 22:23957713-23957735 CAGGATCCCCTGAAGGGTCTGGG - Exonic
1181606630 22:23983594-23983616 CAGGATCCCCTGAAGGGTCTGGG + Exonic
1181973970 22:26714921-26714943 CAGGCTCCCCAGAAGAAGAGCGG - Intergenic
1182021241 22:27083397-27083419 CAGAATCCCCTGCAGAAGGGAGG - Intergenic
1185045872 22:48528489-48528511 CTGGGCCCCGTGAAGGAGTGTGG - Intronic
950424877 3:12919749-12919771 CAGGGTCCCCGGAAGGAAGGAGG - Intronic
950443889 3:13025166-13025188 AAGGAGCCCCAGAAAGAGTGGGG + Intronic
953022925 3:39127396-39127418 CAGGATACCTTGAAGCTGTGGGG - Intronic
954131698 3:48564360-48564382 CAGCATCCCCTGGAGGAGTCGGG - Exonic
955976161 3:64482291-64482313 CAGGATGCTCTGGAGGAGAGGGG + Intergenic
956739393 3:72263470-72263492 CAGGAAGCTCAGAAGGAGTGGGG - Intergenic
960038852 3:113128882-113128904 CATGATCCCTTCATGGAGTGCGG - Intergenic
960977611 3:123190734-123190756 CAGGTTCGCCTGATGCAGTGTGG - Intronic
961306500 3:125961420-125961442 CAGGAGGGCCTGAGGGAGTGGGG - Intergenic
961984943 3:131122316-131122338 CAGGATATCCTCAAGAAGTGAGG - Intronic
962273466 3:133995152-133995174 CTGGCTCCCCTGGAGGTGTGTGG - Intronic
962321779 3:134396569-134396591 GAGGTTCCCCTGAAGGAGGCCGG - Intergenic
963207347 3:142650471-142650493 CATGATCCCCTGAATCAGAGAGG - Intronic
968505812 4:971010-971032 GAGGATCCCGTGCACGAGTGTGG - Exonic
969357084 4:6634960-6634982 CAAGAACACCTGGAGGAGTGGGG + Intergenic
971807757 4:31382522-31382544 AAGCATCCCCTGAAGCAATGTGG + Intergenic
971953354 4:33383039-33383061 CAGGTTCCCAAGAAGCAGTGAGG - Intergenic
972528816 4:39942928-39942950 AAGGATCTCCTGAAGGATGGGGG + Intronic
977536265 4:98260222-98260244 CAGTGTCCCCTGAAGGACTCCGG + Intergenic
981482941 4:145256482-145256504 GTGGATCTCCTCAAGGAGTGAGG + Intergenic
981742059 4:148013121-148013143 CAGGCTGCCCTGAAGGTGGGGGG - Intronic
984757195 4:183336130-183336152 CAGCATCCCCTTATGGAATGAGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985869023 5:2539120-2539142 GAGGATCCCTTGGAGGAGTGGGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
990173657 5:53083168-53083190 CACAATCCCTTGAAGGAGGGCGG + Intronic
994046259 5:95313747-95313769 CTGGATGCCCCAAAGGAGTGGGG - Intergenic
994198547 5:96946096-96946118 CAAGATCACCTGCAGGAGTTTGG + Intronic
995115147 5:108471001-108471023 GAGGATCTCCAGAAGGATTGAGG + Intergenic
997996882 5:138593838-138593860 CAGGATCCCTTGGAGGTGTTAGG + Intergenic
998075139 5:139230071-139230093 CAGCCTACACTGAAGGAGTGGGG - Intronic
999609154 5:153350718-153350740 AAGGAGACCATGAAGGAGTGGGG + Intergenic
1000382524 5:160641976-160641998 CAGGATCCCTGAATGGAGTGAGG - Intronic
1001489945 5:172148267-172148289 CATGATCAACTGAAGGAATGAGG + Intronic
1003065536 6:2901667-2901689 CAGGCTCACCTGGAGGAGTCAGG - Intronic
1003086649 6:3065578-3065600 CAGGCTCACCTGGAGGAGTCAGG + Intronic
1004533180 6:16473668-16473690 CAGGATCCCACAAAGGAGCGAGG + Intronic
1007493800 6:42245057-42245079 TAGAATCACCTGAGGGAGTGAGG + Intronic
1015176550 6:130315859-130315881 TAGGATCCCCTGATGGACTTGGG + Intronic
1015682902 6:135827655-135827677 AAGGGTGCCCTGGAGGAGTGAGG - Intergenic
1015772723 6:136785524-136785546 CTGTGTCCACTGAAGGAGTGAGG + Intronic
1016826334 6:148391841-148391863 CAGGACCTCCTCAAGAAGTGGGG + Intronic
1017993871 6:159514007-159514029 CAGGGTCCAATGAATGAGTGAGG - Intergenic
1019263883 7:101400-101422 CAGGGTCCCGTGAATGACTGGGG - Intergenic
1021802250 7:24318492-24318514 TAGCATCCCCTGCAGGACTGAGG - Intergenic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022312379 7:29209169-29209191 CAGCCTCTCCTGAAGGGGTGAGG + Intronic
1022818464 7:33935702-33935724 CAGCAGCCCCTGCAGGTGTGGGG + Intronic
1029436172 7:100565197-100565219 CAGGAAGCCCAGGAGGAGTGCGG + Exonic
1034325262 7:150224731-150224753 CAGCCTACACTGAAGGAGTGAGG + Intergenic
1034767939 7:153744515-153744537 CAGCCTACACTGAAGGAGTGAGG - Intergenic
1035017380 7:155778588-155778610 CTGGATGGCCTGGAGGAGTGGGG + Exonic
1035037580 7:155905410-155905432 CAGGGGCTCCTGGAGGAGTGTGG - Intergenic
1035361123 7:158314968-158314990 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361133 7:158314997-158315019 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361169 7:158315113-158315135 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361179 7:158315142-158315164 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361189 7:158315171-158315193 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361217 7:158315258-158315280 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361227 7:158315287-158315309 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361237 7:158315316-158315338 CGGGACCCCCTGAAGGACAGAGG + Intronic
1035361270 7:158315432-158315454 CAGGACCCCATGAAGGACAGAGG + Intronic
1035361278 7:158315461-158315483 CAGGACTCCCTGAAGGATAGAGG + Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1037317599 8:17613534-17613556 CAGTCTCCCGTGAAGTAGTGGGG + Intronic
1037419744 8:18689508-18689530 CAGGATACCAAGAAGGACTGGGG + Intronic
1040944786 8:52873336-52873358 CAGGATACCTTGAAGCAGGGAGG + Intergenic
1044186132 8:89254086-89254108 CCAGATCCCCTGTAGGACTGGGG - Intergenic
1044329257 8:90897178-90897200 AAGGATCCTCTTAAGGATTGTGG - Intronic
1048161392 8:132024882-132024904 GTGGATACCCTGAAGGTGTGTGG - Intronic
1049678391 8:143903822-143903844 CAGGACGCCCTGAAGGGATGGGG - Intergenic
1049800535 8:144515619-144515641 CTAGCTCCCCTGAAGGAGGGTGG - Intronic
1051249382 9:15144041-15144063 CAGTATCCCATGAGGTAGTGGGG + Intergenic
1053010526 9:34630338-34630360 GAGGATTCCCGGGAGGAGTGGGG - Intergenic
1056363959 9:85884561-85884583 GTGGATCCCCTCATGGAGTGAGG + Intergenic
1056859941 9:90171623-90171645 CAGGATCCAATGTAGGAGAGCGG - Intergenic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1059461330 9:114432320-114432342 CAGGAGCCCCAGGAGGAGAGGGG + Intronic
1060733231 9:126050769-126050791 CGGGATCCACAGAAGGGGTGTGG + Intergenic
1060827572 9:126695585-126695607 CTGGATCCCCTGGAGGGGCGGGG + Intronic
1061687677 9:132295557-132295579 CAGGGTCCCCCTAAGGTGTGTGG + Intronic
1062446731 9:136598371-136598393 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446759 9:136598469-136598491 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446773 9:136598518-136598540 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446806 9:136598641-136598663 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1185520415 X:734481-734503 CAGGGTCCCCAGAGAGAGTGGGG + Intergenic
1185621309 X:1452757-1452779 GAGGATCTCCTGACGGCGTGGGG + Exonic
1187036302 X:15543963-15543985 CAGTATCTCCTGCAGGACTGAGG - Intronic
1190832464 X:54071490-54071512 CATGAATCCCTGAAGGAGAGAGG - Exonic
1192669661 X:73126776-73126798 GCAGATCCCCTGAAGGGGTGGGG + Exonic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1196686531 X:118514989-118515011 TAAAATCTCCTGAAGGAGTGAGG - Intronic
1196741429 X:119029281-119029303 CATGATCACCTGAATGACTGGGG - Intergenic
1200706492 Y:6447287-6447309 CAGGATCCCCTGAGGCTCTGTGG + Intergenic
1201027620 Y:9717421-9717443 CAGGATCCCCTGAGGCTCTGTGG - Intergenic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic