ID: 948404172

View in Genome Browser
Species Human (GRCh38)
Location 2:237705025-237705047
Sequence CTGTCAGACCCCGCTGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948404172_948404178 12 Left 948404172 2:237705025-237705047 CCGAGAGCAGCGGGGTCTGACAG 0: 1
1: 0
2: 0
3: 13
4: 220
Right 948404178 2:237705060-237705082 GAGGCCTGCAAGTCTGGAGCAGG 0: 1
1: 0
2: 6
3: 29
4: 237
948404172_948404177 6 Left 948404172 2:237705025-237705047 CCGAGAGCAGCGGGGTCTGACAG 0: 1
1: 0
2: 0
3: 13
4: 220
Right 948404177 2:237705054-237705076 GTTTTGGAGGCCTGCAAGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 121
948404172_948404175 -10 Left 948404172 2:237705025-237705047 CCGAGAGCAGCGGGGTCTGACAG 0: 1
1: 0
2: 0
3: 13
4: 220
Right 948404175 2:237705038-237705060 GGTCTGACAGGGCATTGTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
948404172_948404176 -7 Left 948404172 2:237705025-237705047 CCGAGAGCAGCGGGGTCTGACAG 0: 1
1: 0
2: 0
3: 13
4: 220
Right 948404176 2:237705041-237705063 CTGACAGGGCATTGTTTTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948404172 Original CRISPR CTGTCAGACCCCGCTGCTCT CGG (reversed) Intronic