ID: 948406320

View in Genome Browser
Species Human (GRCh38)
Location 2:237722755-237722777
Sequence GAGTGGTGAAGAGGCCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948406316_948406320 -10 Left 948406316 2:237722742-237722764 CCAAACAAGCCCAGAGTGGTGAA 0: 1
1: 0
2: 1
3: 5
4: 138
Right 948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 194
948406313_948406320 10 Left 948406313 2:237722722-237722744 CCTCCTAATGTTTATAGGCACCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 194
948406314_948406320 7 Left 948406314 2:237722725-237722747 CCTAATGTTTATAGGCACCAAAC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 194
948406311_948406320 29 Left 948406311 2:237722703-237722725 CCTGGAGATGAGAGTCAAACCTC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948406320 Original CRISPR GAGTGGTGAAGAGGCCTGCG TGG Intronic
900211263 1:1456928-1456950 GAGTGGGGGTGAAGCCTGCGGGG + Intronic
900354680 1:2254637-2254659 GAGGGGTGAAGTGGACTGGGAGG + Intronic
900474947 1:2871751-2871773 GGGTGGTGAAGGGACCTGGGGGG + Intergenic
901775405 1:11557153-11557175 GAGTGGAGAAGAGCCCAGGGAGG - Intergenic
902235186 1:15052946-15052968 GAGTGAGGAAGAGGCCTGGGTGG - Intronic
902810426 1:18885065-18885087 CAGTGGTGGAGAGGTCTGGGTGG + Intronic
902856799 1:19212411-19212433 TAGTGATGAGGAGGCCTGCTGGG + Intergenic
903121627 1:21220077-21220099 GATCGGTGATGAGGCCTTCGTGG + Exonic
903234983 1:21944361-21944383 GGGTGGTCAGGAGGCCTGGGTGG - Intergenic
903285405 1:22273691-22273713 GGGTGGTGCTGAGGCCTGAGGGG + Intergenic
904402192 1:30264081-30264103 AAGTGGTAAAGAGGGCTGCCTGG - Intergenic
904473708 1:30751263-30751285 GAGGGGTGAGGAGGCCGGTGGGG - Intronic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
913241631 1:116835113-116835135 GAGGGGTGAAGAGGGCTGCATGG - Intergenic
914852580 1:151326187-151326209 GAGGGATGAACAGGCCTGCGTGG - Exonic
916205846 1:162315537-162315559 GAGAGGTGAGGATGACTGCGAGG + Intronic
916693239 1:167211142-167211164 GAGTGGTCAGGAGACCAGCGTGG - Intergenic
918289623 1:183094151-183094173 GAGTGGTGAGGAGGCCAGTGCGG - Intronic
923112287 1:230901894-230901916 GAGTGGTGGTGGGGCCAGCGGGG - Intergenic
923296941 1:232603410-232603432 GAGAGGTGGAGAGGCCAGCAAGG + Intergenic
924905942 1:248452839-248452861 GATGGGTGATGAGGCCTGTGAGG - Exonic
924921947 1:248639195-248639217 GATGGGTGATGAGGCCTGTGAGG + Exonic
1063224976 10:4007249-4007271 ATGTGGTGAAGAGGGCTGTGGGG + Intergenic
1063279328 10:4607966-4607988 GAGTGGCACAGAGGCCTCCGAGG - Intergenic
1065025044 10:21533940-21533962 GCGTCGGGAAGAGGCCTGGGAGG - Intergenic
1065099529 10:22320623-22320645 GGGCGGGGAAGAGGCCGGCGCGG + Intronic
1068809993 10:61244539-61244561 GAGTGATCAAAAGGCCTGCTAGG - Intergenic
1069833417 10:71294516-71294538 GAGAGGTGGAGAGGCCTGTTGGG + Intronic
1070334429 10:75441462-75441484 GTGTAGTGAAGAGGGCTGGGTGG + Intronic
1070913557 10:80138239-80138261 GGATGGTGGAGAGGCATGCGTGG - Intronic
1071363883 10:84878947-84878969 GAATGGAAAAGAGGCCTGCGTGG + Intergenic
1071505054 10:86227145-86227167 CAGTGGGGAAGAGGCTTGAGAGG + Intronic
1076799008 10:132812104-132812126 GAGTGGTCAGGAGGCAGGCGTGG - Intronic
1077497656 11:2894186-2894208 CAGTGGTGAAGATGCCAGCCTGG + Intronic
1077607514 11:3622039-3622061 GAGTGGTGGAGAAGCATGCAGGG + Intergenic
1080587273 11:33693443-33693465 GAGTGGTGAATAAGCTTGCTGGG + Intergenic
1081991589 11:47340928-47340950 GAGTGGAGGGGAGGCCTGCGTGG + Intronic
1085042403 11:73334405-73334427 CAGTGGTGAAGAGACCAGCCTGG + Intronic
1085104308 11:73829101-73829123 GAGTGGAGAAGAGGCTGGAGAGG - Intronic
1085329215 11:75633766-75633788 GAATGCTGAAGAGGCCAGTGAGG + Intronic
1088522288 11:110712521-110712543 GAGGGCTGAGGAGGGCTGCGGGG - Intronic
1088783987 11:113164203-113164225 GAGTGGAGAAGAGGACTCCATGG + Intronic
1089281171 11:117375634-117375656 GGGTAGTGAAGAGGCCTGGTGGG + Intronic
1089351831 11:117825684-117825706 GAGTGGGGAGGCTGCCTGCGAGG - Intronic
1091842655 12:3631842-3631864 GAGTGGTCCAGAGTCCTGCCTGG - Intronic
1091998916 12:5017396-5017418 GTGTGGGGAAGAGGGCTGCCTGG + Intergenic
1092236152 12:6811021-6811043 CAGTGGGGAAGAGGACTGTGTGG + Intronic
1093433037 12:19105415-19105437 AGGTGGTGAAGAGGCATGCCAGG + Intergenic
1096232845 12:49906138-49906160 GAATGGCCAAGAGGCCTGTGTGG - Intergenic
1097182961 12:57181269-57181291 GAGTGGCCAGCAGGCCTGCGAGG + Exonic
1098167140 12:67710299-67710321 GAGAGGTGAAAGGGCCTGAGGGG + Intergenic
1103017021 12:117502933-117502955 GAGATTTGAAGAGGCCTGGGTGG + Intronic
1103119679 12:118371408-118371430 GAATGATCAAGAGACCTGCGCGG - Intronic
1103593111 12:122006232-122006254 GAGAGGTGAAGAGGCCCTCCTGG - Intergenic
1105541439 13:21320393-21320415 GAGCTGTGAGCAGGCCTGCGGGG - Intergenic
1112803409 13:103136725-103136747 GGGTGGTGACAAGGCTTGCGGGG - Intergenic
1118839604 14:69500714-69500736 GTGTCCTGAAGAGGCCTGAGAGG - Intronic
1120385886 14:83845293-83845315 GAAAGGAGAAGAGGCCTGTGAGG - Intergenic
1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG + Intergenic
1125907814 15:43409568-43409590 GTGTTGAGAAGAGGCCTGGGAGG - Intronic
1127914239 15:63442303-63442325 GAGTGGGGAAGAGGAAGGCGGGG - Intergenic
1128570529 15:68730114-68730136 GGGAGGGGAAGAGGCCTGCCTGG + Intergenic
1128762014 15:70223514-70223536 GAGAGGTGCTGAGGCCTGAGGGG - Intergenic
1128764161 15:70240892-70240914 GAGTAGTAAGGAGGCCTGCCTGG + Intergenic
1129019931 15:72507470-72507492 GAGTGAGGAAGAGGACTGAGGGG - Intronic
1129693272 15:77725665-77725687 GGGTGGGGAAAAGGCCTGCCTGG + Intronic
1129725346 15:77898809-77898831 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1129850592 15:78791454-78791476 GAGAGGACAAGAGGCCTCCGAGG + Intronic
1130273385 15:82464001-82464023 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1130465736 15:84191372-84191394 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1130486955 15:84403438-84403460 CAGTGGTGACGTGGCCTGGGAGG - Intergenic
1130498529 15:84482164-84482186 CAGTGGTGACGTGGCCTGGGAGG - Intergenic
1130588025 15:85195968-85195990 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1131294331 15:91133972-91133994 AAGTGGTGAAGAGGCATGGGAGG - Intronic
1131672263 15:94632232-94632254 GAGAGATGAAGAGGCCGGCAGGG - Intergenic
1132206982 15:99993092-99993114 GAGAGCCGAGGAGGCCTGCGAGG - Exonic
1132850853 16:2024268-2024290 GGCTGGAGAAGAGGCCTGGGAGG + Intergenic
1132939188 16:2498612-2498634 GCGTCGTGAAGACGCCTGGGAGG + Intronic
1136004368 16:27318639-27318661 AAGAGGTGAGGAGGCCTGTGGGG - Intronic
1136080376 16:27848691-27848713 AAGTGGTGAAGAGTCCTTGGAGG + Intronic
1137547714 16:49415917-49415939 GAGTGGAGATGAGGGGTGCGCGG - Intergenic
1141037870 16:80643880-80643902 CAGTGGGGAAGATGTCTGCGGGG - Intronic
1141148433 16:81547898-81547920 CAGAGCTGAAGAGGCCTGCCTGG - Intronic
1142682947 17:1561339-1561361 GAGTAGTGAAGAGGGGTGCGTGG - Intronic
1143001004 17:3794997-3795019 GAGTGCTGAGCAGGCCTGCTGGG - Intronic
1143116050 17:4582398-4582420 GAGTGGGGGAGGGGCCTGCAGGG + Intergenic
1145960718 17:28885182-28885204 GGGAGGTGCAGAGGCCTGGGAGG - Intronic
1150414405 17:64975535-64975557 GAGTGGTGTCGAGGCCTGTTGGG - Intergenic
1150984033 17:70175243-70175265 ACGTGGTGAAGATGTCTGCGAGG - Exonic
1152178861 17:78805494-78805516 GAGTCATGAGGCGGCCTGCGGGG - Intronic
1152813070 17:82391293-82391315 CAGTTGTGGAGAGGCCTGGGTGG - Intronic
1153228133 18:2913059-2913081 GAGCCGTGAAGACCCCTGCGGGG - Exonic
1156303229 18:35853681-35853703 GAGTGGTCAAGATGCATGTGTGG + Intergenic
1157287655 18:46388020-46388042 GAATGGCAAAGAGGCCTGCTTGG - Intronic
1157327583 18:46680170-46680192 GAGTGATGTAGAGGCCCGAGGGG + Exonic
1157407836 18:47438406-47438428 GAGTGGTGCAGAGATCTGTGTGG - Intergenic
1159922480 18:74238256-74238278 GAGTTTTCAGGAGGCCTGCGAGG - Intergenic
1160251527 18:77207541-77207563 GAGAGGTGAAAAGCCCTGGGTGG + Intergenic
1161104573 19:2436998-2437020 CAGTTGTGAAGGGGCCTGTGGGG - Intronic
1161139093 19:2637393-2637415 GAGGGGTGCAGGCGCCTGCGGGG - Intronic
1161364307 19:3869215-3869237 GAGTGGTTAAGAGGAGGGCGGGG - Intergenic
1161514893 19:4690976-4690998 GGGAGGTGAAGGGGCCTGGGAGG + Intronic
1161634213 19:5377150-5377172 GAACAGTGAAGAGGCCTGTGTGG + Intergenic
1161713859 19:5864659-5864681 GTGTGGTGAAGTGGGCTGTGTGG - Intergenic
1162144840 19:8607337-8607359 GGGTGGAGGAGAGGCCTGGGAGG - Intronic
1163125156 19:15240520-15240542 GAGTGGGGAATAGGACTGTGGGG - Intronic
1163443563 19:17333878-17333900 GAGTGGTGAGGAGCCCTGGCGGG - Intronic
1165714256 19:38034410-38034432 GAGTGGTGAAGCTGCCTGCCAGG + Intronic
1168705802 19:58469720-58469742 GAGAGGTGGAGAGTCCTGTGAGG - Exonic
925385959 2:3461825-3461847 GGGTGGTGAAGAGGCCACCAGGG - Intronic
926121895 2:10245781-10245803 GAGTGGGGACGTGGCCTCCGTGG + Intergenic
928089277 2:28364080-28364102 GAGCGGTGATAAGGCCTGAGTGG - Intergenic
932494317 2:72138951-72138973 GAGGGGTGAGGAGGCCTGGTTGG - Intronic
936469117 2:112782409-112782431 ACCTGGTGAAGCGGCCTGCGGGG + Intronic
936609119 2:113984305-113984327 GAGTGGTGCAGAGGCTGGTGCGG + Intergenic
937361214 2:121231465-121231487 GAGAGGTGAAGTGGACTCCGGGG - Intronic
940517492 2:154698976-154698998 GCGTGGTGAAGAGGTCCGAGAGG - Exonic
944221435 2:197308489-197308511 GGGTGGGGAAGTGGCCTGGGTGG - Intronic
946300830 2:218823062-218823084 GAGGGCTGAAGAAGCCTGTGGGG + Exonic
946326591 2:218987614-218987636 CAGTGGGGAAGTGGCCTGCTGGG + Intergenic
946378957 2:219331761-219331783 GAGAGGTGGGGAGGCCAGCGTGG + Intronic
946635432 2:221719829-221719851 TTGTGGAGAAGAGGCCTGCATGG - Intergenic
948164008 2:235847045-235847067 GGGTGGTGCAGAGGCCACCGTGG + Intronic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
1170330818 20:15208785-15208807 CAGTAGTGAGGAGGCCTGCTGGG + Intronic
1170370253 20:15640393-15640415 GAGTTGGGAAGAGGCCAGAGGGG + Intronic
1170515991 20:17130867-17130889 GCATGGTGAAGGGGCCTGCATGG + Intergenic
1172025084 20:31943059-31943081 GAGTGGGGGGGAGGCCTGGGTGG - Exonic
1173251280 20:41365418-41365440 GCGTGGGGAAGAGGCCAGCCCGG + Intronic
1174629843 20:51946688-51946710 GAGTGGTTGAGAGGCCTTCAGGG - Intergenic
1175018986 20:55824447-55824469 GAGGGGTGAAGGGGCTTGCCAGG - Intergenic
1175088909 20:56485581-56485603 GAGTGGGGAAGAGGTCAGTGGGG + Intronic
1175358027 20:58384480-58384502 GTGTGGTGAGGAGGTCTGGGAGG + Intergenic
1175360350 20:58405324-58405346 GAGTGGTGGAGGGGCCTGCGGGG + Intronic
1178411272 21:32365662-32365684 GAGTAGAGAGGAGGCCTGTGTGG - Intronic
1181790618 22:25262937-25262959 GTGTGTTGCAGAGGTCTGCGTGG - Intergenic
1181826434 22:25519993-25520015 GTGTGTTGCAGAGGTCTGCGTGG - Intergenic
1182551006 22:31100681-31100703 CAGTGGGGAGGAGGCATGCGGGG + Intronic
1183156709 22:36081361-36081383 GAGTGCTGAAGAGGCCTAAGAGG - Intergenic
1183667418 22:39253781-39253803 GAGCTGGGAAGAGGCCTGCCTGG - Intergenic
1184242412 22:43218122-43218144 GAGAGATGCAGAGGCCTGCCGGG - Intronic
1184285957 22:43471648-43471670 GAGGAGGGAAGAGGGCTGCGTGG - Intronic
1184694865 22:46133591-46133613 GTGGGGTGAAGAGGCCAGCAGGG - Intergenic
952888263 3:38024875-38024897 GAGTGGTGTCGAGGCGTGGGTGG + Intronic
954377512 3:50202946-50202968 GGGAGGTGAAGAGGCTTGCTGGG + Intergenic
954693718 3:52409729-52409751 GCAGGGTGAAGAGGCCTGGGTGG + Exonic
961528792 3:127526790-127526812 GAGCGGTGAAGAGGGCAGTGTGG + Intergenic
966822711 3:183937660-183937682 CAGTGCTGAAGAGGCCAGAGAGG - Intronic
969513588 4:7633615-7633637 GAGTGGTGAAGACGCATAAGTGG + Intronic
969565030 4:7972256-7972278 GAGTGGAGAAGAGGCGTGCAAGG - Intronic
969636167 4:8370521-8370543 GATGGGGGAAGAGGCCTGCAGGG + Intronic
969849195 4:9943229-9943251 GAGTGGGGAAGTGGCCTGCCAGG + Intronic
970130289 4:12862160-12862182 GAGTGGGGAGGATGCCTGCACGG + Intergenic
970192712 4:13530724-13530746 GAGTGGTGAACAGGCTTTGGTGG - Intergenic
970455130 4:16216097-16216119 GTGTGGTGAAGTGGCCTCTGGGG - Intronic
972846637 4:42999405-42999427 GTGTGGTGAAGAAGCCTGAAAGG - Intronic
973263568 4:48187621-48187643 GAGTTGTGAAGAGGGTTGCCAGG - Intronic
978032989 4:103958797-103958819 GAGTGGTGAATAGGCAAGCACGG + Intergenic
978839534 4:113193719-113193741 GAGTGGTGGTGAGGACTGAGAGG + Intronic
981221553 4:142242887-142242909 GAGTGGTGGAGAGAGCTGTGTGG + Intronic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
982369544 4:154619988-154620010 GAGTGGTTCAGAGGCCTATGTGG - Intergenic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
990717109 5:58649547-58649569 GGGTGGTTAAGAGACCTGGGAGG - Intronic
992141037 5:73797361-73797383 GAGTGTTGAAGTGGCCTCCAGGG - Intronic
997883142 5:137608454-137608476 AAGTGGTGAAGAGGGCTCTGGGG - Intergenic
998385797 5:141756514-141756536 GAGGGGTGGATAGGCCTGAGAGG - Intergenic
1001645509 5:173278805-173278827 GAGTGGTGAGGGGGCCTGGGTGG + Intergenic
1004300964 6:14456662-14456684 GAGTGGAGAAGAAGCTGGCGTGG + Intergenic
1004339465 6:14795526-14795548 GAGTTGTGCAGAGGCCAGTGAGG - Intergenic
1006316158 6:33293123-33293145 GGGTGCAGAAGAGGCCTCCGGGG - Exonic
1006337053 6:33426289-33426311 GGGTGGGGAAGAGGTCTGGGGGG - Intronic
1007292346 6:40797277-40797299 GAGTGGTGGAGAGGCCTCTCTGG - Intergenic
1018418302 6:163620421-163620443 CAGTGGTGGACAGGCCAGCGAGG - Intergenic
1019325002 7:433671-433693 GAGTGGTGACGTGGCTTGCCTGG - Intergenic
1019356803 7:584430-584452 GAATGGGGAAGAGGCCGGGGTGG + Intronic
1019449003 7:1086767-1086789 GCGTGGTTCAGAGACCTGCGTGG - Intronic
1022281806 7:28918546-28918568 GACTGGGGAAGAGGCCTTCTGGG + Intergenic
1026340743 7:69431923-69431945 GAGTGGTGGGGAGGCGTGCTAGG - Intergenic
1029189902 7:98764343-98764365 GAGTGATGGAGAGGCATGCTGGG - Intergenic
1029950994 7:104585360-104585382 GAATGCTGAAGAGCCCTGTGCGG - Intronic
1031004178 7:116453397-116453419 GAGTCGTGAGGAGGCCAGCGTGG - Intronic
1034075495 7:148227209-148227231 GAGTGAAGATGAGGCCTGAGAGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035774711 8:2179208-2179230 GCGTGGTTAAGAGTCCTGGGCGG + Intergenic
1037535650 8:19821362-19821384 GAGTGATGAAGCTGCCTGCCAGG - Intronic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1039757827 8:40542071-40542093 GTGTGGTGGAGAGGCCGGAGGGG + Intronic
1041402069 8:57456684-57456706 CAGAGGTGAAAAGGACTGCGTGG + Intergenic
1041785037 8:61622454-61622476 GAGGGATGAACAGGCCTGGGTGG - Intronic
1043514953 8:80987321-80987343 CAGAGGTGATGAGGCCTGTGTGG + Intronic
1044575663 8:93766698-93766720 GAGTGATTAAGAGGACTGTGAGG + Intronic
1044722806 8:95167410-95167432 AAGGGGTGAAGAGGCGAGCGCGG - Intergenic
1045819400 8:106318465-106318487 GAGTGGGGAAGAGGCTAGCAAGG - Intronic
1047675646 8:127198494-127198516 GAGTGGTAAGGAGGCCAGTGTGG + Intergenic
1049199030 8:141330983-141331005 TAGAGGTGCAGAAGCCTGCGGGG + Intergenic
1049675345 8:143886621-143886643 GAGGGGTCATGAGGCCTGCCTGG - Intergenic
1049758379 8:144320804-144320826 GAGTGGTGGCCAGGCCTGCAGGG + Intronic
1053095593 9:35325248-35325270 GAGTTGTGAAGAGGAATGAGGGG + Intronic
1057516425 9:95725660-95725682 GAGTCGTGAAGAGCCCAGCGGGG + Intergenic
1057862491 9:98652588-98652610 GAGTGGGGAAGAGGCGGGTGTGG - Intronic
1057873138 9:98733042-98733064 GTGTGGTGATGAAGCCTGCTGGG - Exonic
1060866927 9:127007903-127007925 CTGTGGAGAAGAGACCTGCGAGG + Intronic
1186613211 X:11159117-11159139 GAGTGATGAGGAGGTCTGTGAGG + Intronic
1186799228 X:13076683-13076705 GGGTCGTGAAGAGGCCTTCTGGG - Intergenic
1190123825 X:47685958-47685980 GACTGGTGAAGAGGACTGACTGG - Intergenic
1190755811 X:53400937-53400959 GAGTGGTGGAGAGGTCAGCAGGG - Intronic
1195760884 X:108245218-108245240 GAGTGGTGAAGAAGACTTCTTGG - Intronic
1199643070 X:149881894-149881916 GGGTGGTGAACAGCCCTGCCAGG + Intronic
1199882025 X:151981508-151981530 GAGTAGTCGAGAGGCCTGCAGGG + Intergenic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic