ID: 948406697

View in Genome Browser
Species Human (GRCh38)
Location 2:237726831-237726853
Sequence AAGCCCATGCTTTGACTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948406695_948406697 6 Left 948406695 2:237726802-237726824 CCTTATAGATGAATTAAGGGACA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 948406697 2:237726831-237726853 AAGCCCATGCTTTGACTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948406697 Original CRISPR AAGCCCATGCTTTGACTTAA GGG Intronic
911980280 1:104558333-104558355 AAGCCCCTACTTTAACTCAAAGG - Intergenic
912067099 1:105757542-105757564 TAACCAATGGTTTGACTTAAAGG + Intergenic
912892086 1:113544412-113544434 ATGCCCATCCTTTGCCTTTAAGG + Intronic
918902949 1:190449478-190449500 GAGACCATGCTTTTACTGAAGGG - Intronic
919515560 1:198517683-198517705 AAGCCCTTCACTTGACTTAATGG + Intergenic
920640709 1:207749265-207749287 AAGCCAAAGCTTTGAATGAAGGG - Intergenic
920760451 1:208779053-208779075 CAGCCCATTCTTTGCCTTATAGG - Intergenic
920837167 1:209521843-209521865 AAGCCCATGTTTTCCATTAAAGG + Intergenic
1068871998 10:61955402-61955424 ATGACCATGTCTTGACTTAAAGG + Intronic
1069828574 10:71269096-71269118 TATCCCATGCTTTCCCTTAAAGG - Intronic
1074738432 10:116460213-116460235 AAGACCTTGCTTTGTCTTCAAGG - Intronic
1081889589 11:46529635-46529657 AAGTCCATGCCTTGACGAAAGGG + Intronic
1086840597 11:91679121-91679143 AAGCCTATGCTTTCACTCACCGG - Intergenic
1090639126 11:128715725-128715747 AAGGTCATGCTTTGAATTCAAGG + Intronic
1091701624 12:2667109-2667131 AAGCCCAGGCATTGACTTCAGGG + Intronic
1097507252 12:60490328-60490350 AAGCCACTGCTGTGACTTAATGG - Intergenic
1104060326 12:125262528-125262550 AAGCCCACGCCTTAACTAAAGGG - Intronic
1104578602 12:129991525-129991547 AAGCCTAAGCTTTGACTTTCTGG - Intergenic
1105810824 13:23993691-23993713 AAGCCCATCCTTTGGCTAGAGGG + Intronic
1107595409 13:41958849-41958871 AAGCCTATACTTTGATTTACTGG + Intronic
1109091312 13:58049811-58049833 ATGCACTTGGTTTGACTTAAAGG + Intergenic
1110183331 13:72643337-72643359 AAGCACTTTCTTTGACTTCATGG - Intergenic
1112555341 13:100462958-100462980 TAGCTCATGCTGTGACTTTAAGG + Intronic
1115087715 14:29537324-29537346 AAGGCATTGCTTTGACTTACTGG + Intergenic
1115960622 14:38833039-38833061 AAGGCCATGCTGAGATTTAAAGG + Intergenic
1119202993 14:72772123-72772145 AAGCCCATGCTCTTTGTTAAAGG - Intronic
1119624744 14:76163111-76163133 AAGCCCATGCGTTCACTGAAGGG - Intronic
1120542392 14:85766239-85766261 AAGCCCATCCTTAAACATAAGGG - Intergenic
1123134981 14:106019301-106019323 AAACCCAAGCATTGACTTACTGG - Intergenic
1123585525 15:21757171-21757193 AAACCCAAGCATTGACTTACTGG - Intergenic
1123622166 15:22199759-22199781 AAACCCAAGCATTGACTTACTGG - Intergenic
1124844619 15:33278480-33278502 AAGCCCAAGCCTTGAGCTAATGG - Intergenic
1124844657 15:33278928-33278950 AAGCCCAAGCCTTGAGCTAATGG + Intergenic
1126317422 15:47385247-47385269 AAGCCCCTTACTTGACTTAATGG - Intronic
1127241894 15:57125036-57125058 AAGGCAATGCTTAGACATAACGG - Intronic
1128241117 15:66101582-66101604 TAGCCCATTCTTTGCCTTCATGG - Intronic
1131878375 15:96835123-96835145 AAGCCTAGGAATTGACTTAAGGG - Intergenic
1135061838 16:19277754-19277776 AAGCCCTTACTTTGACTGGAGGG + Intergenic
1135119947 16:19757191-19757213 AAGCACATGCTGTGAGTTCAGGG - Intronic
1135480609 16:22817873-22817895 AAGCCCCTCCTTTGGGTTAAGGG - Intronic
1146590071 17:34121195-34121217 AAGGCCATGCTTTTCCTTCAAGG - Intronic
1147844372 17:43394515-43394537 CAGCCCATGCTCTGAAGTAAGGG - Intergenic
1156176192 18:34549401-34549423 AAGCCTGTGCTTTGATTTAAAGG + Intronic
1156772288 18:40743201-40743223 AAGCCCCTGCTTTGAAATACGGG - Intergenic
1156956147 18:42966282-42966304 AAGGAAATGCTTTGAATTAATGG + Intronic
1158915372 18:62121059-62121081 AAGTCCAGGCATTGACTTTAAGG + Intronic
1162136641 19:8559428-8559450 AAGCCCAGCCTTTGGCATAAGGG + Intronic
1163131057 19:15273268-15273290 CACCCCATGCTTTGACTGAAAGG + Intronic
1164536844 19:29092568-29092590 AAGCATATGCTTTGTCTAAAAGG - Intergenic
1167702491 19:51058331-51058353 AAGCCCCAGCTTTGACTGAGTGG - Intronic
931326122 2:61225882-61225904 AAGGCCATGATATGACTTATAGG - Intronic
931654769 2:64500901-64500923 AGACCCATGCTTTGACTGAAAGG + Intergenic
931992685 2:67806981-67807003 AAGCACATGCCTTGTCTAAAGGG - Intergenic
943617904 2:190115081-190115103 AAGCCTAGGCTTTGGCTTATGGG + Intronic
945584080 2:211635173-211635195 AAGTCCAAGCTTAGACTAAAAGG + Intronic
946465513 2:219908607-219908629 AAGTCCATACCTTGACTTTAAGG + Intergenic
948406697 2:237726831-237726853 AAGCCCATGCTTTGACTTAAGGG + Intronic
948968366 2:241403027-241403049 CAGCCCATTCTTTTCCTTAATGG + Intronic
1169709160 20:8542112-8542134 AAGGCTATGCTTTGTCTAAATGG + Intronic
1170470232 20:16661340-16661362 AAGCCCATGCACTGACTAAAGGG + Intergenic
1170485654 20:16813288-16813310 AAGTCAATGCTTCGCCTTAATGG - Intergenic
1182046155 22:27275754-27275776 CAGCCCAAGCTTAGACTTAGAGG + Intergenic
1183563113 22:38592597-38592619 CAGCCCATGATTTAACTTCATGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
953237342 3:41118206-41118228 ATGCCCATACTTTGCTTTAAAGG + Intergenic
955655298 3:61239237-61239259 AATTCCATACTTTGACTTCAAGG + Intronic
956369820 3:68546933-68546955 CAGCCCCTTCATTGACTTAAAGG - Intergenic
956904157 3:73748572-73748594 AAATCCATGCTTGGGCTTAAGGG + Intergenic
959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG + Intronic
960547929 3:118938345-118938367 AAGCTCCTGCTTTGTCTAAAGGG - Intronic
962113842 3:132480791-132480813 AAGAATATGCTTTGCCTTAAAGG + Intronic
962286125 3:134086809-134086831 AAGCCCAGGCTATGACTCAGTGG - Intronic
964955710 3:162353482-162353504 AAGGTCATGCTGTGACTGAAAGG + Intergenic
967466203 3:189808557-189808579 AAGCCCATCCTTGGACTTGGGGG - Intronic
972729765 4:41782840-41782862 AAGACAATGCCATGACTTAAAGG + Intergenic
975834006 4:78401626-78401648 AAGGACATGCTTTCAATTAAAGG + Intronic
975995783 4:80312297-80312319 AAGGCCATGCTTTGGTTAAAGGG - Intronic
977178472 4:93843312-93843334 AAGTACATGCTTTGAACTAAAGG - Intergenic
977775509 4:100914951-100914973 AATCCTATGCTATGATTTAAAGG + Intergenic
978686286 4:111448148-111448170 AGGGCCTTGCTTTGGCTTAAGGG + Intergenic
979123643 4:116936975-116936997 AAGCACTGGCTTTAACTTAAAGG + Intergenic
981601514 4:146494274-146494296 AAGCACATGCTTTGATTCCAAGG + Intronic
984604294 4:181766808-181766830 AAGCTCATGTTTTGATTTACAGG - Intergenic
986242847 5:5976950-5976972 GAGCCCATGCTTTGTCCAAATGG + Intergenic
987885523 5:23807060-23807082 TAGCCAATGGTTTGGCTTAATGG + Intergenic
990450643 5:55929281-55929303 AAGCCCATGCTGTTTCTAAAGGG + Intergenic
993787695 5:92164276-92164298 TAGCCAATGGTTTGACTGAATGG - Intergenic
993915038 5:93734068-93734090 AAGATCATGCTTTGAAATAAGGG + Intronic
994840118 5:104912581-104912603 AAGACCATGATTTATCTTAAGGG + Intergenic
996789242 5:127274878-127274900 AAGCCCTTGCTTTTTCTTTAGGG + Intergenic
997665429 5:135626453-135626475 AAGCCAAGGCTTTGGCTTGAGGG - Intergenic
998582030 5:143386514-143386536 AATCCCATTCTTTTATTTAAAGG + Intronic
999483192 5:151967562-151967584 AAGGCCTTGCCTTGACTTACTGG + Intergenic
1000312573 5:160059399-160059421 AATCCAAGGCTTTGGCTTAAGGG + Intronic
1004823751 6:19398535-19398557 AGCCCCATGCTATGACTTAAAGG + Intergenic
1006001341 6:30967482-30967504 AAGCCCATACTTTAACTGGAGGG - Intergenic
1008880796 6:56378397-56378419 GAGCCCTTGCTTGGACTTTAAGG + Intronic
1008975769 6:57424615-57424637 AAGGCATTGCTTTGATTTAATGG - Intronic
1009164303 6:60321722-60321744 AAGGCATTGCTTTGATTTAATGG - Intergenic
1009412230 6:63379130-63379152 AAGCACATGCTTTTAATTGAGGG - Intergenic
1021198331 7:17697366-17697388 AAGCCAATGTTTTGTCTTCATGG + Intergenic
1023685849 7:42734610-42734632 AAGCCCATCATTTTACATAAAGG - Intergenic
1028107040 7:86890398-86890420 ATGCCCATCCTTTGCCTCAAAGG - Intronic
1028839948 7:95418388-95418410 AAGCCTTTGCTCTGACTTAAAGG + Intronic
1030192103 7:106820415-106820437 AAGCCCTTGCTGTGACTTGTGGG - Intergenic
1031984382 7:128153761-128153783 AAGTCCTTGCTTTGGCCTAAAGG + Intergenic
1032703978 7:134406228-134406250 AAGGACATACTTTGTCTTAAAGG + Intergenic
1035199543 7:157252434-157252456 AAGCCCATTCTTAGGCTTGATGG + Intronic
1036204744 8:6796875-6796897 AAGCCCATGCTCTAACTTCAGGG - Intergenic
1038857196 8:31346844-31346866 TAGCCCCTGCTTAGACTAAAGGG + Intergenic
1043007138 8:74833824-74833846 AAGCCCATGCTTTAAATCAGGGG + Intronic
1050213030 9:3286035-3286057 AAGCCCATTATTTGACTGCAAGG - Intronic
1052072214 9:24095169-24095191 AAGCCCATTATGTGACTGAAGGG + Intergenic
1055991294 9:82109234-82109256 AATTCCATCCTTTTACTTAAAGG + Intergenic
1060783832 9:126433486-126433508 AAGCCCATCGTTTCACTTATTGG + Intronic
1061312178 9:129771000-129771022 AAGCCCCTGCTTTGACTAGAGGG + Intergenic
1062153205 9:135032077-135032099 AAACCCATGTTGTGCCTTAAAGG + Intergenic
1192497839 X:71628111-71628133 AAGACCATGATGTGACTTTAGGG + Intergenic
1194598103 X:95884683-95884705 AAGAGCATGGTTTGTCTTAACGG - Intergenic
1196235104 X:113270632-113270654 AAAGCCATGCTTTTACTTTATGG + Intergenic
1196613454 X:117740302-117740324 AAGACCATGCTTTCATTAAATGG + Intergenic