ID: 948407567

View in Genome Browser
Species Human (GRCh38)
Location 2:237733873-237733895
Sequence GCCCCCACCAAGCCCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 322}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948407558_948407567 6 Left 948407558 2:237733844-237733866 CCCGCACCCCCTCCCACTGTGCA 0: 1
1: 0
2: 7
3: 42
4: 516
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407555_948407567 15 Left 948407555 2:237733835-237733857 CCCTGCTGCCCCGCACCCCCTCC 0: 1
1: 0
2: 5
3: 114
4: 929
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407561_948407567 -1 Left 948407561 2:237733851-237733873 CCCCTCCCACTGTGCATGCACCG 0: 1
1: 0
2: 1
3: 17
4: 155
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407554_948407567 18 Left 948407554 2:237733832-237733854 CCACCCTGCTGCCCCGCACCCCC 0: 1
1: 1
2: 15
3: 181
4: 1362
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407565_948407567 -7 Left 948407565 2:237733857-237733879 CCACTGTGCATGCACCGCCCCCA 0: 1
1: 0
2: 1
3: 24
4: 214
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407557_948407567 7 Left 948407557 2:237733843-237733865 CCCCGCACCCCCTCCCACTGTGC 0: 1
1: 0
2: 3
3: 32
4: 572
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407564_948407567 -6 Left 948407564 2:237733856-237733878 CCCACTGTGCATGCACCGCCCCC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407563_948407567 -3 Left 948407563 2:237733853-237733875 CCTCCCACTGTGCATGCACCGCC 0: 1
1: 0
2: 0
3: 7
4: 147
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407562_948407567 -2 Left 948407562 2:237733852-237733874 CCCTCCCACTGTGCATGCACCGC 0: 1
1: 0
2: 1
3: 13
4: 159
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407556_948407567 14 Left 948407556 2:237733836-237733858 CCTGCTGCCCCGCACCCCCTCCC 0: 1
1: 2
2: 19
3: 175
4: 1643
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407553_948407567 19 Left 948407553 2:237733831-237733853 CCCACCCTGCTGCCCCGCACCCC 0: 1
1: 0
2: 7
3: 83
4: 809
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407559_948407567 5 Left 948407559 2:237733845-237733867 CCGCACCCCCTCCCACTGTGCAT 0: 1
1: 0
2: 1
3: 61
4: 589
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322
948407560_948407567 0 Left 948407560 2:237733850-237733872 CCCCCTCCCACTGTGCATGCACC 0: 1
1: 0
2: 4
3: 30
4: 330
Right 948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG 0: 1
1: 0
2: 2
3: 40
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948407567 Original CRISPR GCCCCCACCAAGCCCAGAGC CGG Intronic
900208085 1:1440012-1440034 GCCCCATCCCCGCCCAGAGCCGG + Exonic
900622376 1:3593342-3593364 GTCCCCTCCGAGCCCCGAGCTGG - Intronic
900737690 1:4309387-4309409 GCCCCCACCCACCCCACAACAGG - Intergenic
901145958 1:7064762-7064784 GCCCCCACCATGCCCCGAATGGG - Intronic
902032156 1:13430795-13430817 GGCCTCACCCAGCCCAGAGAGGG + Intergenic
902380733 1:16051087-16051109 CCCCCCACCACCACCAGAGCTGG - Intronic
903541621 1:24099616-24099638 GCCACCGCCGAGGCCAGAGCAGG - Intronic
903685416 1:25128153-25128175 CCCCTCCCCAAGCCCAGATCTGG + Intergenic
904009434 1:27381393-27381415 GCACCCTCCAGGCCCAGAGAGGG - Intronic
904331193 1:29758638-29758660 CCCACCACCTACCCCAGAGCTGG - Intergenic
904415488 1:30358925-30358947 CCCACCACCTACCCCAGAGCTGG + Intergenic
904623769 1:31790801-31790823 GTCCCCACCAAGCCCTGCTCCGG - Exonic
904661562 1:32089418-32089440 CACCACACCCAGCCCAGAGCTGG + Intronic
905471446 1:38195300-38195322 GCCCTCACCAAGCTTACAGCTGG - Intergenic
906153803 1:43602560-43602582 GCCCCACTCAAGGCCAGAGCTGG + Intronic
907272646 1:53299912-53299934 CCCACCACCAGGCCCAGAGTGGG + Intronic
910159759 1:84260316-84260338 GCCCACACTCAGCCCTGAGCAGG + Intergenic
912954664 1:114146404-114146426 GGCCCCAGCAAGCCCAGAGTGGG - Intronic
913222140 1:116667870-116667892 GCCCCCGCCAGGCCCGGGGCCGG - Intergenic
915169756 1:153969402-153969424 GCCCACATCCTGCCCAGAGCAGG + Exonic
915563211 1:156699738-156699760 GCCCCAAACCAGCCCAGAGCAGG - Exonic
920086120 1:203418583-203418605 GCCACCACCATGGCCAGTGCAGG + Intergenic
920686168 1:208110459-208110481 GGCCCCACCTTGCCCTGAGCTGG + Intronic
922155694 1:223038474-223038496 AGCCCAACCATGCCCAGAGCGGG - Intergenic
922465950 1:225845720-225845742 GCCCCCACCCCTCCCAGCGCAGG + Exonic
922642294 1:227246045-227246067 GCCCCCCTCTGGCCCAGAGCCGG - Intronic
1063130615 10:3173608-3173630 GCCCACACCAAGGCCAGAGAGGG - Intergenic
1063452911 10:6163559-6163581 GCGCGCACCGTGCCCAGAGCGGG - Intronic
1064654902 10:17547179-17547201 TCCCCCACAAAGCCCAGGGTAGG - Intergenic
1065554853 10:26905487-26905509 GGCCTCAGCCAGCCCAGAGCGGG - Intergenic
1067428294 10:46225737-46225759 GCCTCGCCCCAGCCCAGAGCTGG + Intergenic
1068688955 10:59896382-59896404 ACTGGCACCAAGCCCAGAGCTGG + Intronic
1069636645 10:69929257-69929279 GCCCCAACCAGACCCACAGCGGG + Intronic
1069913932 10:71775661-71775683 TCCCTCCCCAAGCCCAGACCTGG + Intronic
1070306035 10:75239711-75239733 GCCCCCACCAGGCAGAGAGGGGG + Intergenic
1070724932 10:78781408-78781430 GCCCCCGCGAGGCCCAGGGCAGG + Intergenic
1071418501 10:85464161-85464183 GCCCCCCTCTAGCCCAGGGCAGG - Intergenic
1071489055 10:86123577-86123599 GCTGCTACCAAGCCCAGTGCAGG - Intronic
1071527551 10:86366927-86366949 GCCCCCTCCGAGCCGCGAGCGGG - Intergenic
1072804287 10:98414937-98414959 CTCCCCACCAAGCTCTGAGCAGG + Intronic
1073178697 10:101571128-101571150 GCCCCCATCAGGCCCTGAGGTGG + Intronic
1073320947 10:102615985-102616007 GCCACCGACAAGCCCAGGGCAGG + Intronic
1073459829 10:103660216-103660238 GCCCCCAACAGGGCCAGGGCTGG - Intronic
1074546285 10:114404307-114404329 GCCCCCACCCAGCCCGGACCTGG - Intronic
1074681478 10:115911741-115911763 TCCTCCACCAAGCCCTTAGCAGG + Intronic
1074784325 10:116825685-116825707 TCCCCCACCAATCCCAGCCCTGG - Intergenic
1076332095 10:129677737-129677759 CCCCCCACAAAGCCCTGAGCAGG + Intronic
1076413183 10:130265968-130265990 GGCCCAACCAGGCACAGAGCAGG - Intergenic
1076531710 10:131149363-131149385 GTCCCCAGCAAGCCCAGGCCAGG + Intronic
1076804789 10:132849936-132849958 GCCCCAATCAAGCCCTGTGCTGG - Intronic
1076824268 10:132959374-132959396 GCCCTCGCCATGCCCGGAGCTGG - Intergenic
1076847633 10:133077104-133077126 CCCCCCACCCAGCCCAGCCCAGG + Intronic
1077154634 11:1085838-1085860 GCCCCCAACACGCACATAGCCGG - Intergenic
1077171003 11:1165672-1165694 GGCACCTCCAAGCACAGAGCAGG - Exonic
1077219024 11:1407225-1407247 ACCCACACCAAGCTCAGAGAGGG - Intronic
1078600392 11:12725031-12725053 GCCACCACCAAGCCCAGGCCTGG - Intronic
1079076912 11:17389700-17389722 GGCGCCACCAATCCCAGGGCTGG + Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1083946768 11:65927956-65927978 ACCTTCCCCAAGCCCAGAGCAGG - Intergenic
1084007512 11:66331176-66331198 CCCCCAAGGAAGCCCAGAGCAGG - Intronic
1084024367 11:66438637-66438659 GCCCCCACTAGGCCCAGTGCTGG - Exonic
1084944450 11:72631214-72631236 GCCCCCAGCAAGCCCACGGATGG + Intronic
1089353002 11:117831975-117831997 ACTCCCACAAAGGCCAGAGCTGG - Intronic
1089760261 11:120717799-120717821 CTGCCCACAAAGCCCAGAGCTGG - Intronic
1092047516 12:5442474-5442496 ACCCCCACCATGCCACGAGCAGG - Intronic
1094165234 12:27436465-27436487 GCCCCCACCATGGTCAGGGCTGG - Intergenic
1095097643 12:38156825-38156847 GACCCCACCGGGCCCAGCGCAGG - Intergenic
1095890924 12:47234840-47234862 GGCTCCACCAAGCCCGGACCTGG - Intronic
1096030365 12:48408962-48408984 GGACCCTCCAAGCCCAGTGCGGG + Intergenic
1097040488 12:56153313-56153335 GCCCCCACCCAGCCAAGAACTGG - Intronic
1097981402 12:65741317-65741339 GCCTTCTCCAAGCCCAGGGCAGG + Intergenic
1098060345 12:66554636-66554658 GCCCCCCTCTAGCCCAAAGCAGG - Intronic
1102030233 12:109736097-109736119 GACCCCCCCAACCTCAGAGCGGG - Intronic
1103402518 12:120652948-120652970 GCCTGCACCAGGCTCAGAGCTGG + Intronic
1103614384 12:122142930-122142952 ACCTCCACCCAGCCCAGATCTGG - Exonic
1103963917 12:124626195-124626217 GTCCCCACCCATCCCAGAGGAGG - Intergenic
1105373137 13:19818525-19818547 GTCCCCACAAAGCCCATGGCAGG + Intergenic
1106312832 13:28568697-28568719 GCCCTCACCATCCCCCGAGCTGG + Intergenic
1107553007 13:41494494-41494516 GCCCCCACCCAGCCAAGATCAGG + Intergenic
1110565089 13:76949716-76949738 ACCCCCACAAACCCCACAGCTGG - Intronic
1112190823 13:97175649-97175671 GCCCCCAACAAGAGCAGAGTTGG + Intergenic
1112567739 13:100565795-100565817 GCACCCACCAAGCCCATGCCTGG + Intronic
1115918366 14:38342911-38342933 GCTCCCATCTGGCCCAGAGCAGG - Intergenic
1117446390 14:55807279-55807301 GCTGGCACCAAGCCCAGAGACGG - Intergenic
1117677267 14:58167413-58167435 ACCCCCACCAAGCCAGCAGCAGG + Intronic
1117702559 14:58427959-58427981 GCACTCCCCAACCCCAGAGCTGG - Intronic
1118626038 14:67660103-67660125 GTGCCCAGCAAGCACAGAGCAGG + Intronic
1119651776 14:76389033-76389055 CCCCCCACCAAGCCAAGATATGG + Intronic
1121017698 14:90558384-90558406 GCGCCCACCAAGCCCACCCCGGG + Intronic
1121495559 14:94389528-94389550 GCCTCCAACAACCCCAGAGTGGG - Intronic
1122088143 14:99320984-99321006 GCCCCCAGCCAGCCCAGAGGAGG + Intergenic
1122859368 14:104575663-104575685 GCCCCCACCACACTCAGGGCTGG + Intronic
1122901531 14:104784182-104784204 GCTCCCACCTGGCCCAGGGCTGG - Intronic
1123095574 14:105765581-105765603 GCCCCCACCCAGGCAGGAGCTGG - Intergenic
1123215742 14:106807731-106807753 GCTTCCTCCAAGCCCAGAGACGG + Intergenic
1202859234 14_GL000225v1_random:71559-71581 GTCTCCACCGAGCCCAGAGGAGG + Intergenic
1123947276 15:25244892-25244914 GCACCCACCACGCCCAGGGCAGG + Intergenic
1123948101 15:25248625-25248647 GCACCCACCATGCCCAGGGTAGG + Intergenic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128344372 15:66844236-66844258 GCCTCCAGCAAGCCCAGGTCAGG + Intergenic
1128739272 15:70072511-70072533 ACCACCACCAAGCTGAGAGCTGG + Intronic
1128936005 15:71747105-71747127 TCCCCCACCAAGACCTGAGATGG + Intronic
1129684602 15:77677891-77677913 GCACCCACCATGCCCAGAGGAGG + Intronic
1129691723 15:77717702-77717724 GCCCCCACCAAGCCCAGGCCCGG + Intronic
1129738429 15:77978260-77978282 GCCCCCACCCAGCTCAGACCTGG - Intergenic
1129738872 15:77980224-77980246 GTCCCCACCCAGCCTAGAGACGG + Intergenic
1129847090 15:78772970-78772992 GCCCCCACCCAGCCTGGAGATGG - Intronic
1129847644 15:78775349-78775371 GCCCCCACCCAGCTCAGACCTGG + Intronic
1130254812 15:82320920-82320942 GCCCCCACCCAGCCTAGAGATGG + Intergenic
1130600161 15:85269086-85269108 GCCCCCACCCAGCCTAGAGATGG - Intergenic
1130600710 15:85271410-85271432 GCCCCCACCCAGCTCAGACCTGG + Intergenic
1132538002 16:492846-492868 GCCCCCACAAAGCCCAGCAGAGG - Intronic
1132715687 16:1288920-1288942 GTCCCCACCCACCCCAGGGCTGG + Intergenic
1132731955 16:1367063-1367085 CCCCTCACCCTGCCCAGAGCAGG + Intronic
1132801852 16:1758515-1758537 GCCCCTACGAAGCCCAGCCCGGG + Intronic
1133221243 16:4320001-4320023 GCCCCCACCCATCCCCCAGCAGG - Intronic
1133223235 16:4328119-4328141 GCCCCCACCTGACCGAGAGCCGG + Intronic
1134138294 16:11695264-11695286 GGCCGCACCAAGCCCATAGTGGG - Intronic
1134761311 16:16717595-16717617 TCCCCCACCATGCACAGACCAGG - Intergenic
1134984748 16:18641575-18641597 TCCCCCACCATGCACAGACCAGG + Intergenic
1135222204 16:20622996-20623018 GGCCCCAGCAAGGCCAGGGCAGG - Intronic
1136077731 16:27828399-27828421 GCCATCACCAATCCCACAGCTGG + Intronic
1136228782 16:28875341-28875363 GCACCCACTACCCCCAGAGCTGG - Intergenic
1137397478 16:48126366-48126388 GCCACCTCCAAGCCAGGAGCTGG + Intronic
1137530354 16:49275449-49275471 GGACCCAACAAGCCCAGACCTGG - Intergenic
1137561293 16:49503925-49503947 GCCCCGGCCATGCCCAGAGCAGG + Intronic
1137926368 16:52546181-52546203 TCCCCCACCTACTCCAGAGCCGG - Intronic
1138375857 16:56563517-56563539 GACCCCACCAAGCTGAGAACTGG + Intergenic
1140247287 16:73262959-73262981 GCCCCAACCAAGCCACCAGCAGG + Intergenic
1140965997 16:79966571-79966593 GCCTCCACCCATCCCAAAGCAGG + Intergenic
1141379859 16:83566582-83566604 GACCCGCCCAAGCCCTGAGCAGG + Intronic
1141423380 16:83931227-83931249 CACCCCAGCAAGCCCAGGGCAGG + Intronic
1141499235 16:84432069-84432091 GGCCCCACCCAGCCCCGAGTTGG - Intronic
1141711018 16:85699051-85699073 GGCCACACCAGGCCCAAAGCTGG + Intronic
1142533356 17:597405-597427 GCCACCAGCAAGGCCAGGGCTGG + Intronic
1142967633 17:3591158-3591180 GCCCTCCCCGAGCCCAGCGCTGG + Intronic
1143646243 17:8232095-8232117 GACCCCACCTAGGACAGAGCCGG - Exonic
1143775418 17:9195794-9195816 CCCCCCTCCAGCCCCAGAGCAGG + Intronic
1144802547 17:17940467-17940489 GCCCCCACCCAGCTCAGGGATGG + Intronic
1145905052 17:28511725-28511747 GCCCACACCGAGAGCAGAGCTGG + Intronic
1146263995 17:31439028-31439050 GCCCCCAGGAAGCTCAGTGCAGG - Intronic
1147313377 17:39607512-39607534 CCCCCCACCGAGCCCATCGCAGG + Intronic
1147507151 17:41029947-41029969 GCCACCACCAATGCCACAGCCGG + Exonic
1147923970 17:43935501-43935523 GCCCACACCAACCCCAGAAGGGG - Intergenic
1148124839 17:45231267-45231289 AGCCCCACCCAGCCCAGCGCTGG - Intronic
1148572125 17:48678551-48678573 GCCCCCAGCACTCCCGGAGCTGG + Intergenic
1149286146 17:55166641-55166663 GCCTTCCCCATGCCCAGAGCTGG + Intergenic
1149434311 17:56620075-56620097 GTCCCCACCCTGCCCAGATCTGG - Intergenic
1149473601 17:56940218-56940240 GCCCCCACCACCCCCAAAGGTGG + Intronic
1149517983 17:57294865-57294887 GCCTGCACCCAACCCAGAGCAGG - Intronic
1149777154 17:59366954-59366976 GCCCCCACGATGCTCAGAGCAGG - Intronic
1150074220 17:62179035-62179057 GCCCCCGCCAATACCACAGCTGG + Intergenic
1151355000 17:73553131-73553153 GCCACCTCCATGCCCAGAGTGGG - Intronic
1151470317 17:74313959-74313981 GCCCTCACCAGCCGCAGAGCTGG + Intronic
1151876853 17:76871766-76871788 CCTCCCACCAACCCCAGATCAGG - Intronic
1151903811 17:77034996-77035018 GCCCCCTCCAGGCCCAGCCCTGG + Intergenic
1152322733 17:79617258-79617280 GACCCCCCCATCCCCAGAGCAGG - Intergenic
1152468176 17:80477104-80477126 GGCGCCACTAAGTCCAGAGCGGG + Intronic
1152587981 17:81197559-81197581 GCCCCCACCCGGCCCCCAGCAGG - Intronic
1152679233 17:81657062-81657084 GCCCCCAGCCAGCCCAGAGAAGG + Intronic
1152690334 17:81715173-81715195 GGACCCACCAGGCCGAGAGCTGG + Intronic
1152858381 17:82679758-82679780 GCCTCCACCAAGCACAGGGCAGG + Intronic
1152933765 17:83124289-83124311 GCCCCCAACAAGCCCCCAGATGG - Intergenic
1153750886 18:8228997-8229019 GTCGTCACCAAGCCCTGAGCTGG + Intronic
1155173315 18:23282891-23282913 GCACCCACCATGCACAGTGCAGG - Intronic
1155190187 18:23422767-23422789 GCCCCCAGCATGCACAGTGCAGG + Intronic
1157164750 18:45348176-45348198 GCCTGCAGGAAGCCCAGAGCGGG + Intronic
1157960669 18:52150222-52150244 GCCCTCACCATGCTGAGAGCTGG - Intergenic
1159086792 18:63801697-63801719 GCCCCCACAGAGTCCAGAGGTGG - Intronic
1162301582 19:9847980-9848002 GCCCCCCCCAACCCCTGACCTGG + Intronic
1162396403 19:10420335-10420357 GCCCCCTCCCAGCCCGGAGCGGG + Intronic
1164308856 19:24029327-24029349 TCCCCAACCACCCCCAGAGCCGG + Intergenic
1164671743 19:30076378-30076400 GCCCCCTCCAGGCCAGGAGCGGG + Intergenic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1165247310 19:34505011-34505033 GCCTCCACCCAGCCCAGCTCTGG + Exonic
1166361723 19:42255293-42255315 GGCCCCTTTAAGCCCAGAGCCGG - Intergenic
1166732000 19:45064420-45064442 GCCCCCACCACGGCGAGAGCGGG - Exonic
1166930394 19:46298319-46298341 GCCCCCACCCAGCCAGGAGGGGG - Intronic
1167103164 19:47416571-47416593 CCCCCCACCAACCCCAGGGATGG + Intronic
1167149180 19:47699126-47699148 GGCTCCACCTTGCCCAGAGCGGG - Intronic
1167220776 19:48196788-48196810 TCCCCCAGCAATCCCTGAGCAGG - Intronic
1168127806 19:54296553-54296575 GAACCCCCCAGGCCCAGAGCTGG + Intergenic
1168267714 19:55231520-55231542 GCTCCCAGCAAGCTCGGAGCTGG + Intronic
1168651550 19:58095589-58095611 GCCTCCACCATGCTCAGAGCTGG - Intronic
925329349 2:3046647-3046669 GCCCCCACCAGGCGCTGAGCAGG - Intergenic
925899493 2:8498428-8498450 GCCACCTCCAAGCCCAGATGGGG - Intergenic
926073680 2:9922959-9922981 GGAGCCACCAAGCCCAGACCAGG - Intronic
927819765 2:26253562-26253584 TACCGCACCAGGCCCAGAGCTGG - Intronic
929603924 2:43222302-43222324 TCCCCCACCATGCCAAGACCTGG + Intergenic
932824165 2:74924976-74924998 AGCCCCACCAAGACCAGGGCAGG - Intergenic
933551335 2:83780971-83780993 CCCACCACCAATCCCATAGCAGG + Intergenic
935199519 2:100844207-100844229 ACCCACACCCAGCACAGAGCTGG - Intronic
936488460 2:112947681-112947703 GCCCTCACCCTGCCCAGGGCAGG - Intergenic
940019532 2:149142305-149142327 GCACCTCCCAAGCCCAGTGCAGG - Intronic
946203848 2:218089421-218089443 GCCCCCACCCACCCCAGGGAAGG + Intronic
947751330 2:232534228-232534250 GCCCCCAGCAAGCTCTGAGCAGG + Exonic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948594089 2:239068307-239068329 GGCCCCAGAGAGCCCAGAGCAGG - Intronic
948633024 2:239313989-239314011 GCCAGCACCAAGCCCAGGCCCGG - Intronic
1168928256 20:1600192-1600214 GCTCACATCAACCCCAGAGCAGG + Intronic
1169206049 20:3740906-3740928 GTCTCCAGTAAGCCCAGAGCAGG + Exonic
1169924111 20:10765435-10765457 GCCCCCACCAACCCCAGCCATGG + Intergenic
1170709239 20:18775273-18775295 GCCCCCCTCTGGCCCAGAGCAGG + Intergenic
1170871798 20:20212853-20212875 GTCCCCACAGAGCACAGAGCTGG - Intronic
1171349610 20:24492555-24492577 TCCCCCACCTAGCCCTGAGGTGG + Intronic
1171489574 20:25507538-25507560 CACACCACCTAGCCCAGAGCAGG + Intronic
1172208019 20:33178252-33178274 GCCCCCACCAGGCCTGGATCTGG - Intronic
1172389803 20:34559024-34559046 GCCCCCGCCCAGGCCGGAGCTGG - Intronic
1173224278 20:41152843-41152865 GCCCCCACCAGGCCCAGGCCAGG - Intronic
1173596948 20:44264567-44264589 GCCCCCACCTCCCCCAGGGCTGG - Intronic
1173987884 20:47276574-47276596 GATCCCACCAACCCCAGCGCCGG - Exonic
1175187840 20:57190697-57190719 GGCCCCACCACGCTCAGGGCCGG + Intronic
1175196163 20:57244726-57244748 GCTCCCAGCCAGGCCAGAGCAGG + Intronic
1175268204 20:57715128-57715150 GCCCACGCCAGACCCAGAGCAGG - Intergenic
1175824689 20:61930562-61930584 TCCCCCACCACGTCCAGAACAGG + Intronic
1176092613 20:63325725-63325747 GAACCCTCCAAGCCCAGAGCCGG - Intronic
1176124457 20:63469288-63469310 GCCCCGACCAGGCAGAGAGCAGG + Intronic
1176124997 20:63471412-63471434 GCCCCTTCCAGGCCCAGGGCTGG + Intronic
1176212467 20:63931667-63931689 GGCCCCAGCAAGGCCAGGGCAGG - Exonic
1176417251 21:6483855-6483877 GCCCCCACAAGGAGCAGAGCAGG + Intergenic
1178615434 21:34128961-34128983 GACCCCAGCAAATCCAGAGCTGG - Intronic
1178692116 21:34758902-34758924 GCCTCCAGGAAGCCCGGAGCAGG - Intergenic
1179202363 21:39236452-39236474 GCCCAGACCAGCCCCAGAGCAGG + Intronic
1179585971 21:42374291-42374313 GCCCTCACCACGCCCCGAGGGGG + Intronic
1179627096 21:42654700-42654722 GCCCCAGCCAGGCACAGAGCAGG + Intronic
1179692747 21:43092188-43092210 GCCCCCACAAGGAGCAGAGCAGG + Intergenic
1180005155 21:45017400-45017422 GCCCCAACCAAGCCAAGAGTTGG - Intergenic
1180154538 21:45971597-45971619 CCCCAGACCCAGCCCAGAGCAGG + Intergenic
1181050048 22:20234184-20234206 CCCCCGACCAGGCCCAGAGGTGG + Intergenic
1181669443 22:24419338-24419360 GACTGCACCAGGCCCAGAGCAGG + Intronic
1182440837 22:30362917-30362939 GCCTCCAGCAAGTCCAGGGCTGG - Intronic
1183240282 22:36652729-36652751 GCCACCACCAAGCACATAACAGG + Intronic
1183316834 22:37141642-37141664 GCCCACTCCAATCTCAGAGCGGG + Intronic
1183618659 22:38960101-38960123 GCCCACAGCAAGGCCAGAACAGG + Intronic
1183623860 22:38990024-38990046 GCCCACAGCAAGGCCAGAACAGG + Intronic
1183639561 22:39084745-39084767 GCCCACAGCAAGGCCAGAACAGG + Intronic
1183727457 22:39597578-39597600 ACCCGCACCAAGCCCAGCCCTGG - Intronic
1183935594 22:41260352-41260374 GCCCCCACCAGCTCCAGAGGAGG + Intronic
1184242911 22:43220842-43220864 ACCCTCAGCAGGCCCAGAGCTGG - Intronic
1184457087 22:44616895-44616917 GCCCCCACCCAGGCCAGCCCGGG + Intergenic
1184839059 22:47041953-47041975 CCCTGCACCAAGCACAGAGCAGG + Intronic
1184849556 22:47112491-47112513 GCCTCTGCCAAGCACAGAGCTGG - Intronic
1185035498 22:48474632-48474654 CCCCACACACAGCCCAGAGCTGG - Intergenic
1185277052 22:49954354-49954376 GCCCCCACCAAACCCAGGTGTGG + Intergenic
1185322837 22:50209758-50209780 GTCCCCACCCAGCCCAGCACCGG - Intronic
1185420085 22:50730371-50730393 GATCCCGCCATGCCCAGAGCCGG + Intergenic
950486482 3:13276864-13276886 GCCCCCACCCAGGGCAGACCCGG - Intergenic
951960247 3:28310202-28310224 GCACCCTCCCTGCCCAGAGCAGG + Intronic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
953632293 3:44629318-44629340 GACCCCAGGAAGCCCTGAGCCGG + Exonic
954410711 3:50369749-50369771 GCCCCGAGCAAGCCCAGGCCTGG - Intronic
955065103 3:55527007-55527029 GCCCCCATCCAGGCCAGAACTGG - Intronic
956175649 3:66471033-66471055 GTCCCCACCAACTGCAGAGCTGG - Intronic
956659393 3:71583326-71583348 GCCCCCACCCATCCCAGAGCTGG + Intronic
959913640 3:111793127-111793149 TCCCCCACCCAACCCAGGGCAGG + Intronic
960298049 3:115968096-115968118 GCCCCCTTCCAGCCCAAAGCAGG + Intronic
961216151 3:125162263-125162285 GCCCACAGCAAGCCCCGTGCTGG + Intronic
961661466 3:128470799-128470821 GCCCCCACTCAGACCAGTGCAGG - Intergenic
961662548 3:128477366-128477388 ACCCCCTACAACCCCAGAGCAGG - Intergenic
961830273 3:129619667-129619689 GCCACCACCAAGTCTGGAGCAGG + Intergenic
961988660 3:131164209-131164231 GTCCCCTTCAAACCCAGAGCTGG - Intronic
962162995 3:133019345-133019367 ACCTCGACCAAGCCAAGAGCAGG - Intergenic
963599812 3:147369025-147369047 GCCCCCGCCAGACCCAAAGCAGG + Intergenic
965743855 3:171904643-171904665 GCACCCACAATGCCCAAAGCAGG + Intronic
968807689 4:2786420-2786442 TGCCCCACCCAGCCCAGAGCTGG - Intergenic
968882503 4:3308719-3308741 GGGCCCACCAAGCCCTGAGCAGG - Intronic
968887114 4:3341026-3341048 GCCCCCACCAGGCCGAGAGAAGG - Intronic
969232471 4:5841277-5841299 GCCCCCAGAAGGCCCAGGGCCGG + Intronic
969304568 4:6318377-6318399 GCCCCCGCCAAGCCAAGCCCCGG + Intergenic
969872737 4:10115141-10115163 GCCCCCACTAAGCACAGCACAGG + Intronic
970667448 4:18353973-18353995 GCCCCCCTCCAGCCCAGGGCAGG + Intergenic
973135207 4:46698808-46698830 GGCCTCACCCAGCCCAGAGAGGG - Intergenic
973279162 4:48341520-48341542 GCCTCCCCCAATCCCGGAGCCGG + Exonic
979344179 4:119566812-119566834 GGCCCCAACATGCCCAGTGCAGG + Intronic
982136805 4:152280087-152280109 GTCATCACCATGCCCAGAGCAGG + Intergenic
982668341 4:158292394-158292416 GCCCCCACCAGGAACAAAGCTGG - Intergenic
986171405 5:5317728-5317750 GCCCCCACAAAGCCCAAGCCCGG + Intronic
986239845 5:5951279-5951301 CCCTCCACCAACTCCAGAGCAGG - Intergenic
992994406 5:82318313-82318335 GCCCCCACCATGTCCACAGTGGG + Exonic
998128130 5:139637815-139637837 GCCCCCACCAGGGCAAGCGCAGG - Intergenic
998426969 5:142037008-142037030 GCCCCCACTAGGCCCAGTGCTGG - Intergenic
999194379 5:149772078-149772100 GCCCCAACCCAGATCAGAGCAGG - Intronic
999514632 5:152288636-152288658 GCCCTCACGAAGCACACAGCCGG + Intergenic
1001933195 5:175687422-175687444 GCCCCCACCCCACCCAGGGCAGG - Intergenic
1002235474 5:177799877-177799899 GCTCCCACCCAGGCCATAGCTGG + Intergenic
1002453568 5:179332856-179332878 GCCCCCACCTTGCCCTGATCAGG + Intronic
1002566669 5:180116040-180116062 GCCTCCAGGAAGCCCAGACCAGG - Intronic
1002570737 5:180137976-180137998 CCCCCCACCGAGCCCACAGATGG - Exonic
1002583029 5:180221983-180222005 GACCCCACCAAGCTCAAAGCAGG - Intergenic
1003769911 6:9288773-9288795 CCCTCCACTAAGGCCAGAGCAGG + Intergenic
1006509878 6:34515936-34515958 GCCCCCTCCCTGCCCAGAGTTGG - Intronic
1007785274 6:44276202-44276224 GCCCCCACCGGGCCCCGGGCCGG - Exonic
1009192807 6:60650010-60650032 GCACACACCAAGCACAGAGGTGG - Intergenic
1011914592 6:92488144-92488166 GCTCCCATCTGGCCCAGAGCAGG + Intergenic
1013831487 6:114278018-114278040 GCCCCCTCAAAGCCCATCGCAGG - Intronic
1018791997 6:167155753-167155775 GTCACCACCATGCCCAGAGGAGG - Intronic
1019738770 7:2662758-2662780 GCCCCTAGCTGGCCCAGAGCCGG + Exonic
1019929539 7:4214651-4214673 GCCCCCAGCAAGCCCAAACGTGG - Intronic
1021758760 7:23882615-23882637 GCACCCCACATGCCCAGAGCAGG + Intergenic
1022046413 7:26625771-26625793 GCGCCCAGAATGCCCAGAGCTGG - Intergenic
1023088280 7:36594122-36594144 ACCCCCACCCTGCCCATAGCAGG + Intronic
1024214897 7:47240345-47240367 GCCCACAATAAGCCCAGAGACGG - Intergenic
1026950170 7:74341560-74341582 GCCCTCACCATGGCCAGGGCAGG - Intronic
1026994326 7:74606022-74606044 GTCCCATCCATGCCCAGAGCTGG + Intergenic
1028604613 7:92642293-92642315 GTCACCACAAAGGCCAGAGCTGG - Intronic
1028972623 7:96875703-96875725 CCACCCACCCAGCCCAGGGCAGG - Intergenic
1029745404 7:102513273-102513295 GCCCCCAGGTAGCTCAGAGCAGG - Intronic
1029763343 7:102612252-102612274 GCCCCCAGGTAGCTCAGAGCAGG - Intronic
1030614869 7:111728812-111728834 GCCCCCAGCACCCCCAAAGCCGG + Intronic
1033756096 7:144399121-144399143 GCCCCCACCCAACCCAGTGAGGG - Exonic
1035236136 7:157498721-157498743 GTCTTCACCAGGCCCAGAGCTGG - Intergenic
1035644761 8:1210528-1210550 GCCCCCAGCAAGCACAGCACAGG + Intergenic
1035784793 8:2252066-2252088 CCCTGCACCAAGCCCAGGGCCGG - Intergenic
1035808014 8:2469655-2469677 CCCTGCACCAAGCCCAGGGCCGG + Intergenic
1036397495 8:8381593-8381615 GGCCCTCCCCAGCCCAGAGCGGG - Exonic
1036697872 8:10990492-10990514 GCTCCCACCAGGGCCAGAACAGG - Intronic
1037722086 8:21453347-21453369 GCCATCACCAATGCCAGAGCAGG + Intergenic
1038062626 8:23929501-23929523 GCCCCAGGCAAGCCCAGGGCTGG - Intergenic
1038486026 8:27935805-27935827 GGCTCCACGCAGCCCAGAGCAGG - Intronic
1038679806 8:29656247-29656269 GTCCCCTCCTTGCCCAGAGCAGG - Intergenic
1040671329 8:49694603-49694625 CACCACACCTAGCCCAGAGCAGG + Intergenic
1042816763 8:72886650-72886672 ATCCCCACAAAGCCTAGAGCTGG + Intronic
1045501907 8:102749926-102749948 GCCCCAACAAAGCACAGTGCGGG + Intergenic
1048293929 8:133200500-133200522 GCCACCGCCAAGCCCAGGCCTGG + Intronic
1048326476 8:133443045-133443067 CCCCCCACCAGGCCCAGCTCAGG + Intergenic
1049210701 8:141385182-141385204 GTCCCCACCAGGCCCAGAAGAGG - Intergenic
1049217093 8:141413199-141413221 GCCCCCAGCAGGCCCAGAGGAGG - Intronic
1049601248 8:143508758-143508780 GACCCCACCCAGCCCAGCCCAGG + Intronic
1053159170 9:35801577-35801599 GCCACCCCCAAGCCAACAGCAGG - Intronic
1053442472 9:38127664-38127686 GGCCCCACAGAACCCAGAGCTGG - Intergenic
1053723766 9:40975456-40975478 GCCCCCAGCAGGGCCAGCGCAGG - Intergenic
1054763082 9:69020796-69020818 ACCCCCACCAAGTCAAGACCAGG + Intergenic
1055470778 9:76608117-76608139 GCCCCCTCCAATCCCTGAGGAGG - Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1057167455 9:92940336-92940358 GCCCCAACCAAGCCCCAACCAGG + Intergenic
1057410653 9:94814193-94814215 GGCCCCAACAGGGCCAGAGCAGG - Intronic
1057633809 9:96743535-96743557 GCCACCAGCAAGAACAGAGCTGG - Intergenic
1057701018 9:97363104-97363126 GCCCCCAACCAGCGCACAGCTGG - Intronic
1058908062 9:109497824-109497846 GCCCCCTCGGAGCCCCGAGCCGG + Intronic
1059788712 9:117616505-117616527 TCCACCACCAAGCACACAGCTGG - Intergenic
1060276632 9:122187512-122187534 GCCCCCACCAAAACCAGTGCAGG + Intronic
1060656246 9:125374519-125374541 CACCCCACCAAGCACAGGGCCGG + Intergenic
1060831357 9:126719735-126719757 GACCCAACCCAGCCCAGAGTGGG + Intergenic
1061061032 9:128250640-128250662 GCCCCGCCCCAGCCCAGTGCTGG - Intronic
1061489286 9:130936369-130936391 GCTTCAAACAAGCCCAGAGCTGG + Intronic
1061540995 9:131277713-131277735 GCCCCCCCGAAGCCCCAAGCCGG - Intergenic
1061572205 9:131484797-131484819 GCCCTCACCCAGCTCAGGGCTGG - Intronic
1061626139 9:131841832-131841854 GACCCCAACAGCCCCAGAGCCGG + Intergenic
1061727966 9:132591423-132591445 CCCCCCACCAGAGCCAGAGCTGG - Intergenic
1061919378 9:133774375-133774397 GAGCCCACCAAGCACTGAGCTGG - Intronic
1062037393 9:134388875-134388897 GCCCCCACCAAGCAGGGAGGGGG - Intronic
1062053440 9:134458706-134458728 GCCCCCACCAAACCCTCAGCAGG - Intergenic
1062217563 9:135397489-135397511 GGCTCCACCAGGCCCAGAGGAGG - Intergenic
1062332130 9:136049502-136049524 CCCCCCACCAAGCCTGGAGGAGG - Intronic
1062433977 9:136538302-136538324 GCGACCACCGAGCCCAGCGCAGG + Intronic
1062450794 9:136614912-136614934 GCCACCAGGAAGCCCAGAGGAGG + Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1189160346 X:38803975-38803997 GCCAGCACCAAGCCCTGGGCAGG - Exonic
1190739641 X:53280656-53280678 GCCCCCACCACCCCTAGTGCAGG + Intronic
1191101060 X:56729257-56729279 GTCCCCTCCAGGCACAGAGCTGG - Intergenic
1194877533 X:99208124-99208146 GCTCCCATCTGGCCCAGAGCAGG + Intergenic
1195074489 X:101313147-101313169 GCCACCACCATGCCCAGCCCGGG + Intergenic
1197764566 X:130051441-130051463 GCTCCCACGAAGCCCAGAGGGGG - Intronic
1197981065 X:132218128-132218150 ACCCCCACCAAGCACACACCCGG + Intronic
1200004002 X:153075592-153075614 GCCCCCACCCAGGCCACAGCTGG + Intergenic