ID: 948417261

View in Genome Browser
Species Human (GRCh38)
Location 2:237819401-237819423
Sequence GTGGAGAACCAGGAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 403}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948417261 Original CRISPR GTGGAGAACCAGGAAGTGGG AGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900287008 1:1906670-1906692 GTGGAGAAGCAGGCATGGGGAGG + Intergenic
901143908 1:7052688-7052710 GAGGAGAACCAGGTACTGGGCGG - Intronic
901182637 1:7352162-7352184 GGAGAGAAGGAGGAAGTGGGCGG + Intronic
901572258 1:10171042-10171064 GTGGAGGAACAGGAATTGGTTGG - Intronic
901804525 1:11729721-11729743 GAGAAGAACGAGGAAGTGGGTGG - Intergenic
902041333 1:13494688-13494710 GTGCTGAACCAGGAACTGGGGGG + Intronic
902449009 1:16484969-16484991 GTGGTGGACCAGGAAGGGAGGGG - Intergenic
902823427 1:18956829-18956851 CGGGAGAACCCGGAGGTGGGCGG - Intergenic
902879642 1:19362875-19362897 GTGTTGAACCATGAAGTGGGGGG + Intronic
903211990 1:21823748-21823770 GGGGAGGACCAGGAAGTTTGTGG - Exonic
903424581 1:23244424-23244446 GTGGAGTCACAGCAAGTGGGAGG + Intergenic
903518478 1:23929035-23929057 GAGGAAGAGCAGGAAGTGGGAGG - Intergenic
904420277 1:30386686-30386708 GTGCAGAACAAGGAAGATGGGGG + Intergenic
905022130 1:34825366-34825388 GTGGAAAACAAGACAGTGGGTGG + Intronic
905180737 1:36164633-36164655 GAGGAGATCCAAGAAGTAGGGGG + Intronic
908981771 1:69967415-69967437 GGGGAGAAACAGGTGGTGGGTGG - Intronic
909911637 1:81265589-81265611 GAGGAGAACCAGGAGTTGGGTGG + Intergenic
911551882 1:99292499-99292521 GTGGAGATGCAGGAATTGAGTGG - Intronic
911661561 1:100507745-100507767 GTGGAGAACCTGGGAGGTGGAGG - Intronic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
915222438 1:154385695-154385717 GTGGAGCTCCAGGAAGAGGATGG + Intergenic
915840241 1:159207374-159207396 GTGGAGAAACTTGAAGGGGGAGG + Intergenic
917329769 1:173868732-173868754 GGTGAGAACTAGGAAGGGGGCGG - Intronic
917930704 1:179820753-179820775 GTGGAGAACCAAGTAGTACGAGG - Intergenic
917969893 1:180199775-180199797 ATGGGAAGCCAGGAAGTGGGAGG + Exonic
919093549 1:193002159-193002181 CTGGAGAACAGGAAAGTGGGAGG + Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919857024 1:201712949-201712971 GTGGAGAGCCAGGAAGGCAGAGG - Intronic
922327962 1:224546567-224546589 GTGGAGAACAAAGAAAAGGGAGG + Intronic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922562850 1:226581670-226581692 ATGGACAGCCAGGTAGTGGGTGG + Intronic
922662861 1:227445471-227445493 CTGGAGAACCAGGAAACTGGTGG - Intergenic
922721125 1:227900778-227900800 GTGGAGAGACAGGACGTGGAGGG - Intergenic
922784393 1:228275925-228275947 GTGCAGAACCAGGCGGTGGCGGG - Exonic
923013281 1:230105835-230105857 ATGGACAACTAGGAAGTGGTGGG + Intronic
1063295678 10:4803253-4803275 GAGGAGCACCAGGAAGGGGAAGG + Intronic
1063623710 10:7670248-7670270 GTGGAGACCAAAGAACTGGGTGG - Intergenic
1064965436 10:21011476-21011498 GAGGGGAACCAGGAAGCAGGAGG - Intronic
1065367699 10:24952145-24952167 GAGGAGACCCAGGAAGAAGGAGG + Intronic
1066220601 10:33334412-33334434 CGGGAGAACGAGGACGTGGGGGG + Exonic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066757288 10:38723567-38723589 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1068786095 10:60975923-60975945 GTGGAAAATGAGGAAGTGGAAGG + Intronic
1069923478 10:71832042-71832064 GTGGAGAACCAGGATGTGACAGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1072660675 10:97361645-97361667 GTGGAGAAACAGGAACCGGGAGG + Intronic
1073212801 10:101818422-101818444 GCGGATAAACAGGAAGCGGGCGG - Intronic
1073442181 10:103558802-103558824 GAGGTGAAGGAGGAAGTGGGGGG - Intronic
1073622426 10:105062953-105062975 TTGCTGAACTAGGAAGTGGGTGG + Intronic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1074720858 10:116263967-116263989 CTGGAGATCCAGGAAGAGAGAGG + Intronic
1076242642 10:128921411-128921433 GTGGACAACCAGAAAGTTGCAGG - Intergenic
1079017675 11:16883256-16883278 GTGGAGGAACAGGAAATGCGAGG + Intronic
1080522245 11:33077412-33077434 GTGGACACCGAGGTAGTGGGCGG - Intronic
1080787497 11:35489002-35489024 GAGGAGAACCAGGAAGGAGTAGG - Intronic
1081378713 11:42389157-42389179 TTGGAGGACCATGGAGTGGGGGG + Intergenic
1081780013 11:45703736-45703758 CTTGAGAACAAGGAAGTGTGTGG + Intergenic
1081870869 11:46381967-46381989 GTGGAGCACGCGGAGGTGGGAGG + Intronic
1083373750 11:62203039-62203061 GGGGAGATCCAGGGAGTTGGAGG + Intergenic
1083995310 11:66268826-66268848 GGGCAGAACCCGGATGTGGGGGG - Intronic
1084514229 11:69627521-69627543 GTGGAGTGCCAGGAGGTAGGGGG - Intergenic
1084763661 11:71293563-71293585 TTGGAGCAGGAGGAAGTGGGGGG + Intergenic
1085304116 11:75475595-75475617 GCTGGGAACCAGGAAGTAGGAGG + Intronic
1085917179 11:80903604-80903626 GGGGAGGAACAGGAGGTGGGTGG - Intergenic
1088722543 11:112607179-112607201 GTAGAGATTCAGGCAGTGGGTGG + Intergenic
1088843349 11:113644714-113644736 GGAGAGACCCAGGAAGTGGGAGG - Intergenic
1089794407 11:120968655-120968677 GTGAAGAGCCAAGAAGTGTGTGG - Intronic
1089836187 11:121372730-121372752 GTGGCAGACAAGGAAGTGGGGGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091842477 12:3630889-3630911 GTGGGAGACCAGGAAGTTGGAGG + Intronic
1091936550 12:4439424-4439446 GTGGAGGAAGGGGAAGTGGGAGG + Intronic
1091989372 12:4942383-4942405 GTAGAGAACCAGGACATGAGAGG - Intergenic
1092641439 12:10515160-10515182 GAGGACAAGCAGGAATTGGGGGG - Intronic
1092818925 12:12335212-12335234 GTGAAGAAACAGGGAGTGGCGGG - Intronic
1094258444 12:28464036-28464058 GAGGAGAACCAGCAATTGGGAGG + Intronic
1094268838 12:28588937-28588959 AGGGAGAGCCAGGAGGTGGGTGG + Intergenic
1096003133 12:48145856-48145878 CTGGAGGAGCAGGCAGTGGGTGG + Exonic
1096072351 12:48782412-48782434 GAGGAGGAGCAGGAGGTGGGAGG - Intronic
1096197405 12:49657527-49657549 GTGCAGCAACTGGAAGTGGGTGG - Intronic
1096781768 12:53995980-53996002 GAGGGGAACCAGGGAGGGGGCGG + Intronic
1097166605 12:57089445-57089467 GTGGGGAAGCAGGACGGGGGTGG + Intronic
1097391660 12:59022273-59022295 GAGTAGCACCAGGGAGTGGGAGG - Intergenic
1097889149 12:64759603-64759625 GCGGAGAACCGGGAAAAGGGCGG + Intergenic
1097929752 12:65170245-65170267 GTGGAGGACGAGGAAGGGGAGGG + Exonic
1098478424 12:70933844-70933866 GTCGTGAACCCGGAAGTCGGAGG - Intergenic
1101010428 12:100443900-100443922 GTGGAGAAAGAGGAATTGGGTGG - Intergenic
1101447918 12:104751033-104751055 GTGGAGAAGAAGGAAATGGAGGG + Intronic
1101615587 12:106333880-106333902 TTGTAGAACGAGCAAGTGGGAGG - Intronic
1101925728 12:108969802-108969824 CTCCAGAAACAGGAAGTGGGTGG + Intronic
1102998012 12:117364608-117364630 GTGGAGAAAGAGGGAGAGGGAGG + Intronic
1103011739 12:117463301-117463323 GGGGAGGAACAGGAAGTTGGAGG - Exonic
1103258119 12:119560966-119560988 GTGGATACCCAGGAAGCTGGAGG - Intergenic
1105291842 13:19058374-19058396 GTGGATATCCAGGGAGTGAGGGG + Intergenic
1106832614 13:33601714-33601736 GAGGAGGAGCAGGAAGTGTGGGG - Intergenic
1108514758 13:51190353-51190375 CTGGTGAAACTGGAAGTGGGTGG + Intergenic
1108571026 13:51751401-51751423 GTGGAGAGGCAGGAGGTAGGTGG + Exonic
1110586551 13:77199789-77199811 TTGGAGTACCAGGCAGTGTGAGG - Intronic
1112087024 13:96041987-96042009 GGGGAGGATCAGGCAGTGGGTGG - Intronic
1112666848 13:101585073-101585095 GTTGAGAAACAAGAACTGGGGGG + Intronic
1113632480 13:111897640-111897662 GTGGTGAATTAGGAGGTGGGTGG + Intergenic
1114529902 14:23389067-23389089 GGGGGGCACCAGGAGGTGGGAGG + Intronic
1114577625 14:23728409-23728431 GTGCAGATACAGGAAGTGAGAGG - Intergenic
1115815571 14:37160963-37160985 GAGGAGAAAGAGGAAGGGGGTGG + Intronic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1118294304 14:64554819-64554841 GGGGAGAGCCAGTAAGTGTGTGG + Intronic
1118353535 14:64991731-64991753 ATGGAGAACGTGGAACTGGGTGG + Intronic
1120754473 14:88229353-88229375 AAGGAGAACCAGGTAGTGTGAGG - Intronic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1121997964 14:98619950-98619972 ATTGAAAACCAGGAAGTAGGTGG - Intergenic
1122246434 14:100406496-100406518 GTGAAGAGCCAGGAATTGAGTGG + Intronic
1122378663 14:101286253-101286275 GTGGAGGACCCAGAGGTGGGCGG - Intergenic
1122743867 14:103886942-103886964 GGGCAGAACCATGAAATGGGGGG - Intergenic
1123458018 15:20443645-20443667 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1123632140 15:22268841-22268863 GGGGAGAAAGGGGAAGTGGGAGG - Intergenic
1123660050 15:22556764-22556786 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1124264320 15:28219870-28219892 GTGGAGATCCAGGTTGCGGGAGG - Intronic
1124313911 15:28651259-28651281 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1125825725 15:42674653-42674675 GGGGAGACCCACGCAGTGGGAGG + Intronic
1126583920 15:50264800-50264822 GAGAAGAACCAGGATGTGAGAGG - Intronic
1127047646 15:55043670-55043692 GTGGAGATCCAGGAACTGTTGGG + Intergenic
1127661330 15:61102634-61102656 GAGCAGAACCAGGAAGTTGTGGG - Intronic
1129532329 15:76278416-76278438 GAGGAGAACAAGGAAGTTGAAGG - Intronic
1132587916 16:714373-714395 GTGGAGACACAGGAGCTGGGAGG - Intronic
1133321219 16:4914866-4914888 CTGCCCAACCAGGAAGTGGGGGG - Intronic
1134062316 16:11206515-11206537 GGACAGGACCAGGAAGTGGGTGG + Intergenic
1136284898 16:29234879-29234901 GTGGAAAACCATGCAGAGGGAGG + Intergenic
1136342118 16:29650962-29650984 GTGTAGCAACAGGGAGTGGGAGG + Intergenic
1136702501 16:32157049-32157071 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1136720233 16:32314158-32314180 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1136725286 16:32352551-32352573 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1136765166 16:32770439-32770461 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1136802933 16:33099945-33099967 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1136838609 16:33520434-33520456 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1136843616 16:33558608-33558630 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1137485274 16:48885482-48885504 GTGGGGGACCAGGGGGTGGGTGG - Intergenic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138499771 16:57433163-57433185 ACAGAGAACCAGGAAGTGTGAGG - Intronic
1139869401 16:70093196-70093218 GTGGAGCACTAGGCTGTGGGTGG - Intergenic
1140385984 16:74539017-74539039 GTGGAGCACTAGGCTGTGGGTGG + Intronic
1140655630 16:77136493-77136515 GTTGAAAACCAGGAGATGGGAGG + Intergenic
1141426742 16:83949267-83949289 GGGGAGACCCAGGAAGGAGGTGG - Exonic
1141477508 16:84283700-84283722 GGGGTGAACCCGGATGTGGGTGG + Intergenic
1141604466 16:85144993-85145015 GTGAAGGACCTGGATGTGGGGGG - Intergenic
1141635119 16:85310516-85310538 GGGGAGAAGGAGGAGGTGGGAGG - Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142395617 16:89829589-89829611 GTGGAGGACCAGGAAGGGCCAGG + Intronic
1203001144 16_KI270728v1_random:165203-165225 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1203006198 16_KI270728v1_random:203611-203633 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1203067555 16_KI270728v1_random:1032672-1032694 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1203132747 16_KI270728v1_random:1701607-1701629 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1203148774 16_KI270728v1_random:1820720-1820742 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1203153781 16_KI270728v1_random:1858906-1858928 GGGGAAAACCAGAAAGTGGGAGG + Intergenic
1142752454 17:1997205-1997227 GTGAAGAAGCAGGTAGTGAGCGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143532905 17:7516072-7516094 CTGGAGAACCAGGAAGCTGGTGG + Intergenic
1143741278 17:8955725-8955747 GTGGGGAACAAGGAAGATGGAGG + Intronic
1144363537 17:14520043-14520065 GGGGTGAACCCGGAAGTCGGAGG - Intergenic
1145059965 17:19726688-19726710 GAGGAGAACGAGGAGGAGGGGGG + Intergenic
1145895490 17:28455344-28455366 CTGGAGAACCAGGAAGGTGAGGG - Intergenic
1147256472 17:39185014-39185036 AGGGAGAACCAGGAAGGGTGGGG + Intronic
1147653289 17:42073938-42073960 TTGGTGAACCAGGAAGTGCTAGG - Intergenic
1148198863 17:45734587-45734609 CTAGAGAACCAGGCAGTAGGAGG - Intergenic
1148615320 17:48996739-48996761 GTGGAGAACGAGGAAGCCGCAGG - Intergenic
1148784775 17:50140713-50140735 GGAGAGAAACAGGATGTGGGTGG - Intronic
1148872803 17:50668650-50668672 GCAGAGAACCCGGAAGAGGGAGG - Intronic
1149043643 17:52219731-52219753 GTGGAGGTCCGGGAAGTGAGAGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1150220706 17:63494314-63494336 GGGGAGAACCAGGCTGGGGGTGG - Intronic
1150355392 17:64479793-64479815 GTAGAGAATGAGGAAGAGGGAGG + Intronic
1150867349 17:68867058-68867080 GTGCAGTACCAGGAAGTATGTGG + Intergenic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151699973 17:75737761-75737783 GTGGGGACCCAGGAAGGGGTTGG - Intronic
1151748025 17:76022059-76022081 GTGGGGAGACAGAAAGTGGGGGG + Intronic
1151765945 17:76133118-76133140 GGGGAGGGCCAGGATGTGGGAGG - Intergenic
1151903659 17:77034212-77034234 GTGGAGGAGGAGGCAGTGGGTGG - Intergenic
1152256438 17:79242750-79242772 GTGGAGGCCCAGTAAGGGGGTGG - Intronic
1153157266 18:2163709-2163731 GTGGAGAACCATAAAGGGAGGGG - Intergenic
1153568994 18:6449425-6449447 GAGCAGAGGCAGGAAGTGGGTGG - Intergenic
1153680643 18:7497352-7497374 GAGGAGAAGGAGGAAGGGGGAGG + Intergenic
1154053631 18:10988928-10988950 GTGGAGAGCAGGGAAATGGGAGG + Intronic
1155270630 18:24138534-24138556 GTGGAGAAACAGGAAGTTTCTGG + Intergenic
1156261300 18:35446923-35446945 TTGGAGAACCAGGAGGTGAGGGG - Exonic
1157488722 18:48107627-48107649 GAGGAGAACCCGGTAGTGGGCGG + Intronic
1158012630 18:52746944-52746966 GTGGAGAAGGAGGAAGTGTAAGG + Intronic
1158118432 18:54022916-54022938 GTGAAGCACCAGGACTTGGGCGG + Intergenic
1158886224 18:61829646-61829668 GGGGAGGACCAGGAGGTGAGGGG + Intronic
1160735748 19:661680-661702 GTAGAGACCCAGGAAGGGGCTGG - Intronic
1160899250 19:1419029-1419051 GAGGAGGGCCAGGCAGTGGGAGG - Intronic
1161607355 19:5222446-5222468 GTGGAGGAGGAGGAAGAGGGGGG + Intronic
1161811565 19:6474309-6474331 GTGGAGACAGAGGAAGTGGGTGG + Intronic
1161963306 19:7534634-7534656 TGGGAAAACCAGGAGGTGGGTGG - Intronic
1162099784 19:8332970-8332992 GTGGGACACCAGGAAATGGGTGG - Intronic
1162471092 19:10872192-10872214 GTGGGTGAGCAGGAAGTGGGGGG + Intronic
1162590232 19:11586611-11586633 GTGGTGAAACAGGCATTGGGGGG + Intronic
1163244756 19:16086561-16086583 GCGCAGCAGCAGGAAGTGGGAGG + Intronic
1163366950 19:16880753-16880775 GGTGAAAGCCAGGAAGTGGGTGG - Intergenic
1164575514 19:29403304-29403326 GTGGGGCACCAGGCAGTGGCAGG + Intergenic
1165395867 19:35563322-35563344 GCTGGGAACCAGGCAGTGGGCGG - Intronic
1165425021 19:35740756-35740778 GTAGAGAAGCCGGGAGTGGGCGG - Intronic
1165887048 19:39085549-39085571 GTGGAACACCTGGAAGTGTGGGG + Intronic
1166309435 19:41954482-41954504 GAGGAGACACAAGAAGTGGGTGG - Intergenic
1167711048 19:51111256-51111278 GAGGAGAACTAGACAGTGGGTGG - Intergenic
1167903823 19:52641918-52641940 GTGGAAAAACTGGAATTGGGGGG + Intronic
1168451835 19:56472511-56472533 GTGGAGGAGCCGGAAGGGGGAGG - Intronic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
925675606 2:6358223-6358245 GTGCACAACCCGGAAATGGGGGG - Intergenic
926312749 2:11686348-11686370 AGGGGGAACCAGAAAGTGGGTGG + Intronic
926789822 2:16559028-16559050 GTGGAGCAACAGGTAGTGGTGGG + Intronic
927090955 2:19712222-19712244 GTAGAGCACAAAGAAGTGGGCGG - Intergenic
927841565 2:26448377-26448399 GCCATGAACCAGGAAGTGGGAGG - Intronic
927865327 2:26584227-26584249 CTGCAGCACCAGGAAGTGGAAGG + Intronic
928105857 2:28470155-28470177 GAGGAGGAGGAGGAAGTGGGAGG + Intronic
928106740 2:28475415-28475437 GTGGAGAAGGAGGAAGGTGGTGG - Intronic
928329733 2:30348459-30348481 GTGGACAACATGGCAGTGGGTGG - Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
928899486 2:36302006-36302028 GTGGAGAAACAGGAAGCTAGCGG - Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
929596760 2:43180836-43180858 TGGGAGAACCAGGAAGGGAGAGG - Intergenic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930105911 2:47639308-47639330 CTGGAGAACTAGGGAGTGGGAGG + Intergenic
931430320 2:62203762-62203784 GTGGAGATCCTGGGAGTTGGGGG + Intronic
931852252 2:66263508-66263530 GGAGAGAACCAGGAAGTGCTGGG - Intergenic
932236509 2:70125001-70125023 GTGGAAAATGAGGAAGAGGGCGG + Intergenic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
933997571 2:87680837-87680859 GTAGAGCACCATGAAGTGTGTGG - Intergenic
934320592 2:91968008-91968030 GGGGAAAACCAGAAAGTGGCAGG - Intergenic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
936242159 2:110797136-110797158 GGGGAGAGCCAAGAAGTGAGGGG + Intronic
936296281 2:111270075-111270097 GTAGAGCACCATGAAGTGTGTGG + Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936855831 2:116956278-116956300 GTGGGGAAACAGGAATTAGGGGG - Intergenic
937342251 2:121098766-121098788 CTGGACCACCAGGATGTGGGTGG - Intergenic
937796633 2:126030332-126030354 GTGGAAAACTGGGCAGTGGGAGG - Intergenic
937850853 2:126634432-126634454 GTGGAGCACAGGGAAGTGGCAGG - Intergenic
938617620 2:133015836-133015858 GTGGGCCACCTGGAAGTGGGAGG + Intronic
939065878 2:137482840-137482862 GAGGAAAGGCAGGAAGTGGGTGG + Intronic
940823561 2:158385015-158385037 ATGGTGAGCAAGGAAGTGGGGGG - Intronic
940842018 2:158594650-158594672 GTGAAAAACCAGGAATTTGGAGG + Intronic
941664856 2:168234561-168234583 GTGGAGGAACAGGAAGTTGAGGG - Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942230273 2:173854556-173854578 GCTGAGAACCAGAAAGTGAGGGG - Intergenic
943366241 2:186970101-186970123 GTGGAGGATCAGGAAGGTGGGGG - Intergenic
945196114 2:207238995-207239017 GTAGAGAACTAGGAAGTAGCTGG + Intergenic
945347242 2:208732545-208732567 GAAGAGAAGGAGGAAGTGGGTGG + Intronic
947179990 2:227403249-227403271 GAGGAAACCCAGGAAGGGGGTGG + Intergenic
947818180 2:233051969-233051991 GCGGAGAGCCAGGAAAGGGGTGG + Intergenic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
948541505 2:238694224-238694246 GAGGAGAAAGAGGAAGAGGGAGG + Intergenic
948563169 2:238867234-238867256 GTGGAGAAAGAGGGAGAGGGAGG + Intronic
1170337761 20:15289558-15289580 GTGAAGAACAAGGAAGTGGCAGG + Intronic
1170826354 20:19799465-19799487 GTGGAGGACCAGGAATGGGAAGG + Intergenic
1170962692 20:21039443-21039465 GTGGAGCATCAGCAAGTGGCTGG - Intergenic
1171527903 20:25830255-25830277 GGGGAGTACCAGGCAGTTGGGGG - Intronic
1171548923 20:26025625-26025647 GGGGAGTACCAGGCAGTTGGGGG + Intergenic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1174149202 20:48474273-48474295 CTGGAGAACCAGGGAGGAGGTGG - Intergenic
1174405099 20:50297688-50297710 GGGGAGAATCAGGGGGTGGGAGG - Intergenic
1174592777 20:51659188-51659210 GTGGAGTGCCATGAACTGGGGGG - Intronic
1175010280 20:55727786-55727808 GTGGCAAACCAGGATATGGGAGG + Intergenic
1175253252 20:57622426-57622448 GTGGAGAACCAGTAAGTCTGGGG + Intergenic
1175527897 20:59648209-59648231 GCAGAGAACCAGGCAGTGAGAGG - Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1175975451 20:62708466-62708488 GCGGAGAACAGGGAAGAGGGTGG + Intergenic
1175996073 20:62812891-62812913 ACGGGGACCCAGGAAGTGGGCGG + Exonic
1176940195 21:14913961-14913983 GTAGAGAACCAGGAAGTCCTTGG + Intergenic
1178832246 21:36065743-36065765 GTGAAGGATCAGGAAGTGGGAGG - Intronic
1178982144 21:37273570-37273592 GTGGAGAAGGAGGAGGGGGGAGG + Intergenic
1179149102 21:38795209-38795231 GAGGAGAATGAGGAAGGGGGTGG + Intergenic
1179941411 21:44640905-44640927 CGGGAGAACCAGGAAGGGTGGGG + Intronic
1180057170 21:45364985-45365007 GTGGAGAATGAGGCTGTGGGCGG + Intergenic
1180119925 21:45739397-45739419 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180119943 21:45739452-45739474 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180250727 21:46585680-46585702 GGGGAGGAACAGGCAGTGGGTGG - Intergenic
1180308843 22:11152067-11152089 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1180547320 22:16513878-16513900 GGGGAAAACCAGAAAGTGGGAGG - Intergenic
1181088633 22:20457071-20457093 GCTGAGACCCAGGAAGTAGGGGG + Intronic
1181629407 22:24142707-24142729 GTGGGGCACCAGGAATTGAGTGG - Intronic
1182049039 22:27299253-27299275 GTGGAGGAGCAGGAAGTCTGGGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1183061337 22:35338113-35338135 GTGGGGAGGCAGGAACTGGGAGG - Intronic
1183129671 22:35821894-35821916 GGGGAGGAGCAGGAAATGGGAGG + Intronic
1183771427 22:39929493-39929515 GAGGAGAGGCAGGAAGTAGGTGG - Intronic
1183864156 22:40690807-40690829 TTGGAGATCCTGGAACTGGGAGG - Intergenic
1184309837 22:43634008-43634030 GAGGAGAAGCAGGAAGTGAGGGG + Intronic
1184663090 22:45974567-45974589 TTGGAAATCCAGGAGGTGGGTGG + Intronic
1185098202 22:48822875-48822897 CAGGAGGACCCGGAAGTGGGTGG + Intronic
949232374 3:1766438-1766460 GTGGGGGGTCAGGAAGTGGGAGG + Intergenic
950415064 3:12864408-12864430 GAGGAGGAACAGGCAGTGGGGGG + Intronic
950474495 3:13206987-13207009 GTGGCTAACCAGGAGGCGGGAGG - Intergenic
951120022 3:18915741-18915763 GAGGGGAACCAGGAAGTTGTAGG - Intergenic
951698603 3:25471536-25471558 ATGGATAAACAGGAAGTTGGGGG + Intronic
952271097 3:31832266-31832288 GTGGAGAAGCAGGGAATGAGAGG + Intronic
954266220 3:49472172-49472194 GTGGAGTGGCAGGAAGAGGGAGG + Intronic
954462973 3:50638221-50638243 GGAGAGAACCAGGCAGGGGGAGG + Intronic
955424855 3:58777707-58777729 GTGGGGAAAAAGTAAGTGGGAGG + Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
956780111 3:72596868-72596890 GTGGAAAAGCAGGGAGGGGGTGG + Intergenic
958731817 3:97968092-97968114 GAGGAGCACCTGGCAGTGGGCGG - Intronic
959933073 3:112003356-112003378 GCAGAGAAGCAGGAAGAGGGAGG + Intronic
960269998 3:115663038-115663060 CTGCAGAACCACAAAGTGGGAGG + Intronic
960547936 3:118938386-118938408 GTGGAATAACAGGAAGTGGGTGG - Intronic
960865467 3:122194994-122195016 GAGGAGGAGCAGGAAGTAGGAGG - Intronic
961011692 3:123440641-123440663 GTGGAGAATGAGGAAGTCAGGGG - Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961588678 3:127958343-127958365 GTGGAGAGCCTGGACGTGGTGGG - Intronic
961638329 3:128349067-128349089 GTGGGGAAACAGGAAGGTGGAGG + Intronic
961822765 3:129583686-129583708 GTGGGGAACCAGGAGTTGAGGGG - Intronic
962113729 3:132478648-132478670 GTGGTTCACCTGGAAGTGGGAGG + Intronic
962238957 3:133733947-133733969 GGGGTGAAGCAGGCAGTGGGAGG + Intergenic
962500963 3:135991808-135991830 GTGGAGAAACAGGAAATGTGTGG - Intronic
963435197 3:145258133-145258155 GTGGGGAAGCTGGAACTGGGTGG - Intergenic
963854457 3:150239233-150239255 GTGGACAGGAAGGAAGTGGGAGG + Intergenic
964202042 3:154128565-154128587 CTGGAGTACAAGGAAATGGGGGG - Intronic
964693867 3:159485139-159485161 GTGGATATCCAGGAAGTATGAGG - Intronic
964847515 3:161059839-161059861 CTGGAGCAGAAGGAAGTGGGTGG - Intronic
967241023 3:187439685-187439707 GTGGAGATCCAGGAAGCAGGAGG + Intergenic
967927999 3:194667544-194667566 CTAGAGAAACAGGAAGTGGGAGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970436683 4:16042431-16042453 GTGGAAGACAAGGAGGTGGGAGG + Intronic
971192207 4:24438189-24438211 GTGGAGGAACAGGAAAAGGGAGG + Intergenic
973078144 4:45956294-45956316 GCGGTGTACCAGGAAATGGGGGG + Intergenic
974705965 4:65516002-65516024 GTGGAGAACCAGGAAGCCAGTGG - Intronic
976061679 4:81136151-81136173 GGGGAGAACCTGGAAGGGTGAGG - Intronic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
977802827 4:101258662-101258684 GATGAGGACCAGGAAATGGGTGG - Intronic
980012101 4:127607942-127607964 GTGGCGAAGGAGGATGTGGGGGG - Intergenic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982547262 4:156749430-156749452 GTAGAGAACCATCAGGTGGGTGG + Intergenic
983296296 4:165873342-165873364 GGGGAGACCGAGGAAGGGGGTGG - Exonic
983354910 4:166644652-166644674 GTGGAAAAACAGTAAGTGAGGGG + Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
985031396 4:185794279-185794301 GAGGAAATCCAGGCAGTGGGTGG + Intronic
985506787 5:286031-286053 CTGGAGACCCGGGGAGTGGGGGG + Intronic
985783090 5:1881105-1881127 GTGGAGTAGGAGGAAGTTGGAGG + Intronic
986652595 5:9979431-9979453 GTGGAGAGGCAGGAGGTGGTGGG - Intergenic
986696241 5:10357908-10357930 GTGGAGAACAGTGAATTGGGAGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
988493559 5:31725916-31725938 GTGGAGACCCAGGCAGCTGGAGG - Intronic
990950047 5:61289666-61289688 GCAGAGAACCTGGAAGTAGGGGG + Intergenic
990950192 5:61291108-61291130 CTGGAGCTACAGGAAGTGGGTGG - Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992678445 5:79129054-79129076 ATAGAGAACTAGGAAGCGGGTGG + Intronic
992840634 5:80687976-80687998 GTGGAGAACCAGGACAAGGTAGG + Intronic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994863734 5:105235236-105235258 TTGGAGGAGCAGGCAGTGGGAGG + Intergenic
995494072 5:112723179-112723201 GTGAAGAGCCAGGAACTGGCTGG + Intronic
997265035 5:132490471-132490493 GCGGGGCACCAGGAAGTGGGGGG - Intronic
998221783 5:140288441-140288463 GTGGAGCACAAGGAATTTGGGGG + Intronic
998231792 5:140365617-140365639 GTGGAGACCAAGGCAGTCGGTGG + Intronic
999658101 5:153830206-153830228 GAAGAGAACCAGGAAAAGGGAGG + Intergenic
1001942199 5:175748791-175748813 GTGGAGGACCAGGACATGGCTGG - Intergenic
1004256494 6:14069240-14069262 GTGGAGATCCAGGGAGAAGGTGG - Intergenic
1006030124 6:31171906-31171928 GGGGAAAACCAGGGGGTGGGGGG + Intronic
1006060776 6:31416923-31416945 TTTGTGAACCAGGCAGTGGGAGG - Intergenic
1006140835 6:31928709-31928731 CTGGAGAGAGAGGAAGTGGGTGG - Intronic
1007064185 6:38972793-38972815 GTGGGGAACCAGAAAGTAAGTGG + Intronic
1007415222 6:41687703-41687725 GGTGAGAACAAGGAAGAGGGAGG + Intronic
1007848576 6:44781615-44781637 GAGGTGAACCTGGAAGTAGGGGG - Intergenic
1008700682 6:54095930-54095952 CTGAAGTACCAGCAAGTGGGAGG - Intronic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1009992051 6:70855279-70855301 GTGGAGCACCAGAAAGTAAGTGG + Intronic
1010507056 6:76674008-76674030 TTAGAGAACCAGGATGTTGGAGG - Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011742482 6:90376331-90376353 GTGGAGAGCCAAGAACTGGGAGG - Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011833760 6:91404657-91404679 GGGGAGAAACAGGCAGTGGGTGG - Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1014177212 6:118343683-118343705 GAGGAGAAGCAGGAATTAGGTGG + Intergenic
1014804852 6:125818049-125818071 GGGGAGAAGCGGGAAGGGGGAGG - Intronic
1015902426 6:138081966-138081988 GTGGAGGACAAGGCAGTGGTTGG + Intergenic
1016826402 6:148392346-148392368 GTAGATAAACAGGAGGTGGGAGG - Intronic
1016861390 6:148721990-148722012 GTGGAGAAGAAGGCAGTGAGAGG - Intergenic
1017752405 6:157500288-157500310 GTGGAGAACAAGAGAGTGAGTGG + Intronic
1018040757 6:159919749-159919771 GAGCAGAGCCTGGAAGTGGGAGG + Intergenic
1018063784 6:160111326-160111348 GAGGAGGAGGAGGAAGTGGGGGG - Intronic
1018440887 6:163812154-163812176 CTGGAGAACCAGGAAGTCAGTGG - Intergenic
1018714339 6:166520414-166520436 CTGGAGAACCAGGAAGGCTGGGG - Intronic
1019406963 7:888976-888998 GGGGAGAGCCAGGCAGTGGGTGG + Intronic
1019461309 7:1160332-1160354 GTGGAGAAGCGAGGAGTGGGCGG - Intronic
1019535815 7:1529558-1529580 GTGCAGAACCCGCAAGTGGGGGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1020035439 7:4960452-4960474 GTAGGGAGCCAGGCAGTGGGGGG - Intergenic
1021579680 7:22139538-22139560 GTGCAGAGCCAGGAAGTGGGAGG + Intronic
1021626595 7:22599539-22599561 GTGGAGATCTGGAAAGTGGGTGG + Intronic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1024222198 7:47297649-47297671 GGGGAGAAACAGGCAGTGGGAGG + Intronic
1025297740 7:57789628-57789650 GGGGAGTACCAGGCAGTTGGGGG + Intergenic
1027592446 7:80134353-80134375 GTGGAGAACAGGAAAGTCGGGGG - Intronic
1028777880 7:94701072-94701094 TGGGAGAACCAGGAAATGGGGGG + Intergenic
1029158160 7:98532010-98532032 GTGGAGCACAAGGGAGTGGTGGG - Intergenic
1029248338 7:99218604-99218626 GTGGATAAGGAGGAAGTGGTAGG - Intergenic
1029285230 7:99461107-99461129 ATGGAGGGCCAGGGAGTGGGTGG + Intronic
1030313578 7:108092007-108092029 GAGCAGAACCTGGCAGTGGGGGG - Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1032086805 7:128888760-128888782 GTGGAGCGGCAGGCAGTGGGAGG + Intronic
1032834362 7:135659682-135659704 CAGAAAAACCAGGAAGTGGGTGG + Intergenic
1033036390 7:137879793-137879815 GTGGGGAACCAGGTTGTGGGAGG + Exonic
1033827517 7:145209657-145209679 GTGGAGAACCAAGAAGTAAATGG - Intergenic
1035268320 7:157704578-157704600 GTGGGGAGCCAGGAGGTGGTAGG - Intronic
1035669139 8:1403258-1403280 CTGGAGGACGAGGAGGTGGGGGG - Intergenic
1036032841 8:4992196-4992218 GTGGAGGGCCAGGTAGTGGGCGG - Intronic
1036221257 8:6923202-6923224 GGGGTGACCCAGTAAGTGGGGGG - Intergenic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1037121914 8:15298731-15298753 TAGGAGAAACAGGGAGTGGGAGG + Intergenic
1037220162 8:16509576-16509598 GGGGAATACTAGGAAGTGGGTGG - Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039571857 8:38593170-38593192 GGGGAGGAACAGGCAGTGGGTGG - Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039810469 8:41043808-41043830 GAAGAGAATCAGGCAGTGGGCGG + Intergenic
1039860972 8:41457124-41457146 GTGGAGAACTTGGAACTGGCAGG - Intergenic
1039895902 8:41716355-41716377 ATTCAGAAACAGGAAGTGGGGGG - Intronic
1040035210 8:42863317-42863339 GGGCAGAACCAAGAAGAGGGAGG + Intronic
1040788453 8:51195509-51195531 GAGGTAAACCAGTAAGTGGGAGG - Intergenic
1041740987 8:61156261-61156283 GTGGAGACCCAGGTGATGGGAGG - Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042677181 8:71334565-71334587 GTGGGGAAGCAGGAAGTAAGTGG + Intronic
1043985257 8:86687510-86687532 GTTGAATACCAGGAACTGGGAGG + Intronic
1044561219 8:93614042-93614064 TTGCAAAACCAGGAAGTGGTAGG - Intergenic
1046527459 8:115398763-115398785 TTGATGAACCAGGAAGTAGGCGG + Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1048908032 8:139107201-139107223 GTCAAGAACCAGGAAGAAGGGGG - Intergenic
1048950681 8:139494230-139494252 GTGTACATCCAGGAAGTTGGGGG + Intergenic
1048985673 8:139733498-139733520 GTGGAGGTCCTGGAAGTGGGAGG + Intronic
1049495110 8:142926408-142926430 GTGGAGGACAAGGAACCGGGTGG - Intergenic
1049734844 8:144199483-144199505 GTGGAGAAACAGGTAGGCGGGGG - Intronic
1053163198 9:35827914-35827936 GTGGAGAACCAGAAGATGGGAGG + Intronic
1053450679 9:38191883-38191905 CTGGAAAACCAGGAAGCAGGGGG + Intergenic
1053618615 9:39794259-39794281 GAGGAAGACGAGGAAGTGGGAGG - Intergenic
1054265540 9:62913170-62913192 GAGGAAGACGAGGAAGTGGGAGG + Intergenic
1055195161 9:73581814-73581836 GGGGTGAACCCGGAAGTCGGAGG + Intergenic
1056552063 9:87660182-87660204 GTGGAGGCCCAGGAGATGGGAGG + Intronic
1056847643 9:90054704-90054726 GTGGAGAACAGGATAGTGGGAGG - Intergenic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060679789 9:125552034-125552056 GAGGAGAAGTAGGGAGTGGGAGG - Intronic
1061476951 9:130874238-130874260 TGGGAGAATCAGGAAGTGAGAGG + Intronic
1061498727 9:130990342-130990364 TGGGAGCACCTGGAAGTGGGGGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061761026 9:132851384-132851406 GTGCAGTCCCAGGAAGTGAGTGG + Intronic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186925476 X:14329043-14329065 CTTGAGGACTAGGAAGTGGGAGG - Intergenic
1188478984 X:30618182-30618204 GTGTAGAAACAGGGAGTTGGGGG - Intergenic
1188580506 X:31706230-31706252 GTAGAGAACAAGAAAGTAGGAGG + Intronic
1188923500 X:36009014-36009036 GTGAAGAAAAAGGAAGTGTGAGG - Intergenic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1189907598 X:45777570-45777592 GTGGAGAAGTAGCAAGTAGGAGG + Intergenic
1190289919 X:48985504-48985526 GAAGAGAACCAGGAAGAGAGAGG + Intronic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190481883 X:50885379-50885401 ATGGAGAAACTGGAAGTGAGAGG - Intergenic
1190630570 X:52381480-52381502 GTGGGGAACCAGGAAGGGGCAGG + Intergenic
1190827011 X:54026898-54026920 GTGTAGAAGTAGGAAGTGGCTGG - Intronic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192381959 X:70626359-70626381 GTGGAGAACTAGGGGGAGGGAGG - Intronic
1194767220 X:97855775-97855797 GTGAAGAAAAAGGAAGGGGGAGG - Intergenic
1195923068 X:110002231-110002253 CTGGAGAACCAGGTCGCGGGAGG + Intergenic
1196791475 X:119468645-119468667 GAGCCCAACCAGGAAGTGGGGGG + Intronic
1198616471 X:138463474-138463496 GGGGAGGAACAGGCAGTGGGTGG - Intergenic
1198722549 X:139638463-139638485 GAGGAGCAACAGGAAGTGGTGGG + Intronic
1199629833 X:149769863-149769885 GGGGGGGACCAGGGAGTGGGGGG + Intergenic
1200362250 X:155620897-155620919 GTGGAGAACCAGGCATGGGCTGG + Intronic
1200737840 Y:6819380-6819402 GTGGAGAAATAGGAACAGGGAGG + Intergenic
1201188092 Y:11423113-11423135 GGGGAAAACCAGAAATTGGGAGG - Intergenic