ID: 948420974

View in Genome Browser
Species Human (GRCh38)
Location 2:237859770-237859792
Sequence CTCCCCTAGAGGACACCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948420974_948420995 20 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420995 2:237859813-237859835 CGGGTGGGAGCGGGTGGGGGCGG 0: 1
1: 2
2: 17
3: 200
4: 2070
948420974_948420993 16 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420993 2:237859809-237859831 GGAGCGGGTGGGAGCGGGTGGGG 0: 1
1: 0
2: 11
3: 145
4: 1382
948420974_948420983 -6 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420983 2:237859787-237859809 GGGGAGAGGAGGGGAGCGGGTGG 0: 2
1: 11
2: 320
3: 3109
4: 8625
948420974_948420997 29 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420997 2:237859822-237859844 GCGGGTGGGGGCGGGCGCCGCGG 0: 1
1: 1
2: 25
3: 187
4: 1677
948420974_948420998 30 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420998 2:237859823-237859845 CGGGTGGGGGCGGGCGCCGCGGG 0: 1
1: 0
2: 7
3: 126
4: 931
948420974_948420990 11 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420990 2:237859804-237859826 GGGTGGGAGCGGGTGGGAGCGGG 0: 1
1: 2
2: 16
3: 174
4: 1622
948420974_948420984 -5 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420984 2:237859788-237859810 GGGAGAGGAGGGGAGCGGGTGGG 0: 1
1: 1
2: 42
3: 678
4: 5424
948420974_948420981 -10 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420981 2:237859783-237859805 TCTAGGGGAGAGGAGGGGAGCGG 0: 1
1: 0
2: 23
3: 531
4: 4921
948420974_948420994 17 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420994 2:237859810-237859832 GAGCGGGTGGGAGCGGGTGGGGG 0: 1
1: 0
2: 5
3: 125
4: 1115
948420974_948420989 10 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420989 2:237859803-237859825 CGGGTGGGAGCGGGTGGGAGCGG 0: 1
1: 1
2: 9
3: 106
4: 1141
948420974_948420991 14 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420991 2:237859807-237859829 TGGGAGCGGGTGGGAGCGGGTGG 0: 1
1: 2
2: 8
3: 95
4: 1185
948420974_948420986 1 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420986 2:237859794-237859816 GGAGGGGAGCGGGTGGGAGCGGG 0: 1
1: 1
2: 16
3: 335
4: 2907
948420974_948420992 15 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420992 2:237859808-237859830 GGGAGCGGGTGGGAGCGGGTGGG 0: 2
1: 0
2: 3
3: 92
4: 1117
948420974_948420982 -9 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420982 2:237859784-237859806 CTAGGGGAGAGGAGGGGAGCGGG 0: 1
1: 1
2: 7
3: 131
4: 1353
948420974_948420987 4 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420987 2:237859797-237859819 GGGGAGCGGGTGGGAGCGGGTGG 0: 1
1: 3
2: 13
3: 249
4: 2136
948420974_948420988 5 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420988 2:237859798-237859820 GGGAGCGGGTGGGAGCGGGTGGG 0: 2
1: 0
2: 3
3: 92
4: 1117
948420974_948420996 21 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420996 2:237859814-237859836 GGGTGGGAGCGGGTGGGGGCGGG 0: 1
1: 2
2: 37
3: 361
4: 2709
948420974_948420985 0 Left 948420974 2:237859770-237859792 CCAGCCGGTGTCCTCTAGGGGAG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 948420985 2:237859793-237859815 AGGAGGGGAGCGGGTGGGAGCGG 0: 1
1: 0
2: 37
3: 667
4: 5304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948420974 Original CRISPR CTCCCCTAGAGGACACCGGC TGG (reversed) Intronic
900860619 1:5226659-5226681 CAGCCCTAGAGGAAAGCGGCGGG - Intergenic
901749247 1:11395921-11395943 CTCCCCTAGAAGGCTCCAGCAGG + Intergenic
903679917 1:25089724-25089746 TTCCCCATGAGGACACCGCCAGG + Intergenic
905014939 1:34771380-34771402 CTCACCTAGAGGACACCCTGAGG - Intronic
911144870 1:94542004-94542026 CTGCCCTGGAGGACGCAGGCGGG + Intergenic
913669842 1:121086898-121086920 CTCCTCTAGGGGACACAGACAGG - Intergenic
914021605 1:143874296-143874318 CTCCTCTAGGGGACACAGACAGG - Intergenic
914660093 1:149782247-149782269 CTCCTCTAGGGGACACAGACAGG - Intergenic
916172182 1:162009714-162009736 CTGCCCTGGGGGACACCAGCTGG - Intronic
920048396 1:203148580-203148602 CTCCAATAGAGCACACTGGCTGG - Intronic
1063213073 10:3898901-3898923 CTCCCCTTGAAGACACCTCCAGG + Intergenic
1066061920 10:31731645-31731667 CTACCCTAGAGCACACAGTCTGG + Intergenic
1066364464 10:34763429-34763451 TTCCCCCAGAGGACACAGGTTGG - Intronic
1073064804 10:100751667-100751689 CTCCCCGAGAGCACACTGGAGGG - Intronic
1074654627 10:115570992-115571014 CTCCCCAACATGGCACCGGCTGG + Intronic
1076176699 10:128373784-128373806 CTCCCCTAGAGGGCCTGGGCTGG + Intergenic
1077154837 11:1086618-1086640 CTCCCACACAGGACACCTGCAGG - Intergenic
1078096224 11:8298918-8298940 CTCTCCTAAAGGCCACCGCCTGG + Intergenic
1083878817 11:65538374-65538396 CGCCCCTACAGGCCCCCGGCAGG + Intronic
1089235514 11:117021050-117021072 CTGCATTAGAGGACACCAGCTGG + Intronic
1089756558 11:120691824-120691846 CTCCCCTTAAGGCCACTGGCAGG - Intronic
1097282766 12:57854957-57854979 CTCCACTACAGCACACCTGCAGG - Intergenic
1102096772 12:110247343-110247365 CTGCCCCAGAGGACAAAGGCTGG + Intergenic
1104419091 12:128620359-128620381 CTCCACTAGAGTATACCTGCAGG - Intronic
1109319658 13:60794652-60794674 CTCACTCAGAGGACACCTGCTGG + Intergenic
1114348820 14:21826972-21826994 CTCCTTTAGAGGACACTGGAAGG + Intergenic
1116114884 14:40635470-40635492 CTCCCTTGGAGGACACAAGCTGG - Intergenic
1118381671 14:65222618-65222640 CTCCCCCAGAGGCCCCTGGCTGG - Intergenic
1121427561 14:93863405-93863427 CTCCCCTGGAGGACAGCAACTGG - Intergenic
1122325420 14:100878624-100878646 CTCCCCTCGAGGACACAGTAGGG + Intergenic
1123062914 14:105602251-105602273 CTCCCCTAGAGGTCAGGGGTGGG - Intergenic
1125582873 15:40799366-40799388 CAGCCCTAGAGGATACAGGCAGG - Intronic
1131150276 15:90043270-90043292 CTCTCATAGAGGAGACCTGCGGG + Intronic
1131302355 15:91210694-91210716 CTCCAATAGGGGACACTGGCTGG - Intronic
1133248243 16:4463373-4463395 CTCCCACAGAGGAGCCCGGCAGG + Intronic
1133739422 16:8640366-8640388 CTCCCCTAGGAGAGACTGGCAGG - Intronic
1134058237 16:11183278-11183300 TTCCCCTAGAGGTCACCCGCAGG - Intergenic
1142737135 17:1908227-1908249 CTCCCCAAGGGGACACAGCCAGG + Intergenic
1146132577 17:30291767-30291789 CTCCTCCAGAGGACCGCGGCGGG + Intronic
1148135428 17:45288849-45288871 CTCCCATAGAGGACAGTGGAAGG + Intronic
1148799063 17:50211626-50211648 CTCCTCTTGAGGTCACTGGCAGG + Intergenic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1158545068 18:58389212-58389234 CTCAGGTGGAGGACACCGGCTGG - Intronic
1160010928 18:75106743-75106765 CTCCCCAACAGGAGACCCGCAGG - Intergenic
1161139917 19:2641187-2641209 CTCTCCTTGAGGTCACAGGCAGG + Intronic
1161373776 19:3928477-3928499 TTCCCCTAAAGGGCACCTGCCGG - Intergenic
1162646356 19:12052987-12053009 CTTCCCTGGAGGACAGTGGCAGG + Intergenic
1164397848 19:27881347-27881369 CTCCCCTAGAGAACGCAGACTGG + Intergenic
1168146019 19:54420530-54420552 CTCCACTGCGGGACACCGGCCGG + Intronic
1168717431 19:58537726-58537748 CTACCCTAGAGGCCAGAGGCAGG + Intronic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
937119888 2:119433735-119433757 CTGACCTAGAGGACCCCTGCAGG - Intronic
937808465 2:126172765-126172787 GTCTCCTGGAGGACACGGGCAGG + Intergenic
942196542 2:173526179-173526201 CTGCCCTAGAGGACAGCTGAAGG - Intergenic
943212241 2:184981719-184981741 TTCCCTTAGAGGACACCTGGAGG - Intergenic
948211008 2:236193190-236193212 CTCCCCCGGAGGACACCGGCAGG - Intergenic
948420974 2:237859770-237859792 CTCCCCTAGAGGACACCGGCTGG - Intronic
1170569498 20:17624943-17624965 TTCCCTTTGAGGACACAGGCTGG - Intronic
1171230354 20:23479407-23479429 CTCCCCTAGAACACACAGGGTGG + Intergenic
1176303114 21:5108310-5108332 CTCCCCTCTAGGACAGCCGCTGG + Intergenic
1179853911 21:44153614-44153636 CTCCCCTCTAGGACAGCCGCTGG - Intergenic
1182145132 22:27992872-27992894 CACGCCTAGAGGACTGCGGCAGG - Intronic
950377411 3:12582991-12583013 TTCCCCTAGAGGGCCCTGGCTGG - Exonic
956322328 3:68010405-68010427 TTCCCCTAAAGGACCCTGGCTGG - Intronic
960941378 3:122937264-122937286 CTCCCGGAGAGGGCACTGGCAGG + Intronic
969601123 4:8176991-8177013 TTCCGCTAGAGGACAGCGGCGGG + Intergenic
974202960 4:58664589-58664611 CTTCCCTAGAGGTCAGAGGCTGG - Intergenic
982657739 4:158170649-158170671 CGCTCCTAGAGGACACAGGCCGG + Exonic
986399058 5:7361669-7361691 CTCCCCTAGAGGTCTCCGGATGG - Intergenic
989368340 5:40680162-40680184 CTCCCGCAGACGAGACCGGCGGG + Exonic
991583534 5:68180432-68180454 CTCCCCTCAAGGTCACCAGCTGG - Intergenic
992716367 5:79514416-79514438 CTCCCCTAGAGGCTGGCGGCTGG + Intergenic
998190954 5:140024115-140024137 CTACCCTAGAGGAACCCAGCTGG + Intronic
1006904122 6:37521613-37521635 CTCCCCTGAAGGACAACAGCAGG - Intergenic
1007376054 6:41457303-41457325 CTTCCCTAGAAGACAGCGGGCGG - Intergenic
1014198617 6:118585017-118585039 CTCCCCTAGAGAACCCAGACTGG + Intronic
1018825269 6:167404104-167404126 CTCTCCTGGGGGACATCGGCAGG + Intergenic
1025976872 7:66377083-66377105 CTCCTCAAGAGGCCCCCGGCAGG + Intronic
1027851050 7:83452427-83452449 ATTCCCTAGAGGCCACCTGCAGG + Intronic
1031086348 7:117305135-117305157 CTGCCCTAGAGGACGCGGGCTGG - Intronic
1037682115 8:21106228-21106250 CTCCCCTTCAGCACACTGGCAGG - Intergenic
1038423099 8:27446118-27446140 CTGCTCTGGAGGACACCAGCTGG + Intronic
1042503470 8:69535421-69535443 CTCCCATAGAGCACACTGTCTGG - Intronic
1047348106 8:124048100-124048122 CTCCACTAGTGGACACCAGCAGG + Intronic
1049563337 8:143324423-143324445 GTCCCCCTGAGGACGCCGGCAGG - Intronic
1049747017 8:144267274-144267296 CTCCCCAACAGGGCACAGGCAGG + Intronic
1050340281 9:4630486-4630508 CTCCCCCAGAGAACACCACCTGG + Intronic
1061836568 9:133333577-133333599 CTCTCCCAGAGCACACCTGCTGG + Intronic
1062126135 9:134864053-134864075 CAACCCTAGAGGACATTGGCTGG - Intergenic
1062363342 9:136197695-136197717 CTCCCGTAGAGGCCATTGGCCGG + Exonic
1185467072 X:361506-361528 CTTCCCCAGAGGACGCCCGCAGG - Exonic
1185643493 X:1600980-1601002 CTCTCCTTGGGGGCACCGGCCGG - Exonic
1186778794 X:12892409-12892431 CTTCCCTAGGTGACACTGGCTGG + Intergenic
1187031504 X:15493151-15493173 CTCACCTAGTGGACCCCTGCAGG + Exonic
1189541904 X:42000373-42000395 CTCTCCTAGAGGTCCCCAGCAGG - Intergenic
1199478683 X:148273983-148274005 TTCCCATAGAGAACACTGGCGGG - Intergenic
1200908420 Y:8509374-8509396 CCCCCACAGAGGACACAGGCTGG - Intergenic
1202199537 Y:22331745-22331767 CTCCCCAAGAGGGCACGGGTCGG - Intronic