ID: 948421064

View in Genome Browser
Species Human (GRCh38)
Location 2:237860097-237860119
Sequence GCCGCGGTGACTGCCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948421060_948421064 3 Left 948421060 2:237860071-237860093 CCCGCACCTCGTTTCTCAGGCTG 0: 1
1: 0
2: 1
3: 20
4: 191
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421055_948421064 10 Left 948421055 2:237860064-237860086 CCCCAGCCCCGCACCTCGTTTCT 0: 1
1: 0
2: 2
3: 18
4: 230
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421061_948421064 2 Left 948421061 2:237860072-237860094 CCGCACCTCGTTTCTCAGGCTGT 0: 1
1: 0
2: 0
3: 22
4: 267
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421062_948421064 -3 Left 948421062 2:237860077-237860099 CCTCGTTTCTCAGGCTGTGCGCC 0: 1
1: 0
2: 0
3: 7
4: 159
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421059_948421064 4 Left 948421059 2:237860070-237860092 CCCCGCACCTCGTTTCTCAGGCT 0: 1
1: 0
2: 0
3: 13
4: 129
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421057_948421064 8 Left 948421057 2:237860066-237860088 CCAGCCCCGCACCTCGTTTCTCA 0: 1
1: 0
2: 0
3: 17
4: 182
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
948421056_948421064 9 Left 948421056 2:237860065-237860087 CCCAGCCCCGCACCTCGTTTCTC 0: 1
1: 0
2: 2
3: 18
4: 175
Right 948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948421064 Original CRISPR GCCGCGGTGACTGCCAGCGC AGG Intronic
903077920 1:20786702-20786724 GCGGCGGTGACTGGCTGCGGCGG - Intronic
905067010 1:35192571-35192593 GCCGAGGTGACTGCAGGCGGCGG + Exonic
905416523 1:37808125-37808147 GCCGCGGTGGCTGCCAGCGTGGG - Exonic
905441857 1:38000928-38000950 GCCCTGGCGACTGCCAGCACTGG - Intronic
905519685 1:38588470-38588492 GCCTCGGAGACTGCCAGCTGAGG + Intergenic
906614548 1:47225497-47225519 GCGGCGGGGGCAGCCAGCGCGGG + Exonic
909585259 1:77282023-77282045 GCCGCGCTGCCTGGCAGCCCGGG + Intergenic
910936095 1:92485407-92485429 GGCGGGGTAACTGTCAGCGCCGG + Intronic
922586380 1:226737469-226737491 GCCGCGGCGGCGGGCAGCGCGGG - Exonic
1070733392 10:78847036-78847058 TCCGAGGTGTGTGCCAGCGCTGG + Intergenic
1073453372 10:103622453-103622475 GCCGAGGTGACTGCGGGAGCTGG - Intronic
1075651421 10:124130160-124130182 GACTCGGTGAATGCCAGCCCGGG + Intergenic
1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG + Intergenic
1096192929 12:49631902-49631924 GCTGCGGTGACAGGCACCGCTGG - Exonic
1106620752 13:31368368-31368390 GCCTCTGTGAATGCCAGGGCAGG + Intergenic
1111518284 13:89363449-89363471 GCCGGGGTGCCTGCGAGCGGGGG - Intergenic
1113826249 13:113256295-113256317 GCCGAGGGCACTGCCAGCCCTGG - Intronic
1115046397 14:29000283-29000305 GCACCGGGGACTGCCAGGGCAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119743310 14:77027819-77027841 GCCGCGGAGACAGCCCGGGCGGG - Exonic
1120968878 14:90191267-90191289 GCCCCCGTGACTTCCAGTGCTGG + Intergenic
1121892302 14:97605594-97605616 GCCACGGTGACTGCCTTCACGGG - Intergenic
1122802755 14:104239760-104239782 GCAGCAGGGCCTGCCAGCGCAGG - Intergenic
1133924605 16:10182637-10182659 GCTGCGGTGAGTGCTAGCGCGGG - Exonic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1137716723 16:50602621-50602643 GCCACGGTGACTTCCAGAGAGGG - Intronic
1138516038 16:57536074-57536096 GCCGCGGCGACTGCCAATGGGGG - Intronic
1140406023 16:74712152-74712174 GCCCCTATGACTGCCAGAGCAGG + Intergenic
1141168850 16:81678480-81678502 CCGGCGCTGACGGCCAGCGCAGG + Exonic
1141627118 16:85267154-85267176 GCGGCGGTGGCTGCCTGGGCTGG + Intergenic
1142146300 16:88494290-88494312 GCCATGGTGACTGCCACCGACGG - Intronic
1143168040 17:4908472-4908494 GCCACCGTTCCTGCCAGCGCTGG + Intergenic
1143521139 17:7445070-7445092 GCCGCTGGGACCGCCAGCACAGG - Exonic
1147376738 17:40027073-40027095 GGCGCGGCGCCTGCCAGCGCTGG + Intronic
1148856292 17:50580865-50580887 GCCGCAGTGCCTGCAAGCACAGG - Intronic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1151699164 17:75733576-75733598 GCCGTGGGGAGTGCCAGTGCGGG + Exonic
1155054524 18:22171880-22171902 GCCGCGGGGCCTGGCGGCGCTGG + Exonic
1160242353 18:77132772-77132794 GCGGCGGTGACTGACGGCGGCGG + Intronic
1160751657 19:737249-737271 GCCTCGGTGTCTGCCAGGGCTGG - Intronic
1162551630 19:11361394-11361416 GAGGCTGGGACTGCCAGCGCAGG - Exonic
1164272653 19:23686845-23686867 GGCGCGCTGACAGCCAGCCCCGG - Intronic
1164693351 19:30226587-30226609 GCCGTGGCGCCTGCAAGCGCAGG + Intergenic
1167166619 19:47803430-47803452 GCCCCGGTGAGTGACAGCGGTGG + Intronic
1167175219 19:47860334-47860356 GCCCCGGTGAGTGACAGCGGTGG - Intergenic
1168147748 19:54429374-54429396 GCCGTGGTGAGTGCCAGGGCCGG + Exonic
1168310383 19:55456967-55456989 GCCCCGGTTACTGTCAGCCCTGG + Intronic
926749554 2:16187746-16187768 GGGGCGGTGACTGCCAGTGTTGG - Intergenic
927054853 2:19358465-19358487 GCCGCGGGGACTCCAAGCGCCGG + Exonic
933726599 2:85430777-85430799 GCCCTGGTGACTGCCAGCTGAGG - Intronic
933885894 2:86719529-86719551 GCAGCGCTGACAGCCGGCGCGGG + Intronic
933924286 2:87077176-87077198 GCAGCGCTGACAGCCGGCGCGGG - Intergenic
934567011 2:95346698-95346720 GCAGCGCGGACGGCCAGCGCGGG - Intronic
937950886 2:127387525-127387547 GCCGCGGTGACAGGCCGCGCTGG - Intronic
948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG + Intronic
1170890171 20:20369206-20369228 GCCGCGGTTTGTGCCAGCGGCGG - Exonic
1171532729 20:25863016-25863038 GCCGCGGTGACCTCCAGGACAGG - Intronic
1172095431 20:32457836-32457858 GTCCCGGGGACAGCCAGCGCGGG - Intronic
1173482671 20:43415856-43415878 GCTGCGGTGACTGCAAGGCCAGG + Intergenic
1173939096 20:46894832-46894854 GCCGCGGCTGCTGCCTGCGCCGG - Exonic
1174368688 20:50071780-50071802 GCCTCGGTGGATGCCAGTGCAGG - Intergenic
1175847206 20:62065299-62065321 GCCGCGCTGGCCGCCCGCGCCGG - Exonic
1179999695 21:44989799-44989821 GCCGCCGTGGCAGACAGCGCGGG + Intergenic
1180710451 22:17835908-17835930 GCTGCGGTGAAAGCCAGGGCAGG + Intronic
1181626739 22:24127270-24127292 GCCGCGGTGCCTGTCGGGGCTGG + Intronic
1183660355 22:39216382-39216404 GCAGCAGTGACTGCCAGGGGTGG + Intergenic
1185070076 22:48651359-48651381 GCCGGGCTGACTGCCAGGTCTGG + Intronic
950006929 3:9697392-9697414 GCCGTGTTCACTCCCAGCGCAGG + Intronic
951217590 3:20040058-20040080 CTCACGGTGTCTGCCAGCGCTGG - Exonic
953411679 3:42693753-42693775 GCCACTGTGGCTGCCAGCTCTGG + Exonic
954658333 3:52211646-52211668 AGCGGGGTGACTGCCAGGGCAGG + Intronic
968123642 3:196143202-196143224 CCCGTGGTCCCTGCCAGCGCTGG - Intergenic
968868444 4:3228229-3228251 ACCGCAATGACTGCCAGTGCGGG + Intronic
985764671 5:1770591-1770613 GCCGCTGTGACAGCAAGCACTGG + Intergenic
986297223 5:6449319-6449341 CCCGTGGTGAGGGCCAGCGCCGG + Intronic
998176300 5:139904177-139904199 GCCGCGGTGACAGGCACCGAGGG - Intronic
998936540 5:147235054-147235076 GCGGCGGAGGCTGCGAGCGCCGG - Exonic
1005496178 6:26389821-26389843 ACCTCAGTGACTGCCAGGGCCGG - Intronic
1007415929 6:41691209-41691231 GCCATGGTGGCTGCCGGCGCTGG + Exonic
1017793631 6:157823055-157823077 GCGGCGGTGACTGCCCGGGGCGG + Intronic
1018793490 6:167168619-167168641 GCCGGGGTGGCTCCCAGGGCAGG - Intronic
1018823225 6:167389759-167389781 GCCGGGGTGGCTCCCAGGGCAGG + Intergenic
1025007045 7:55363263-55363285 GCAGCGGTGACTGCCCGCAGGGG - Intergenic
1029413990 7:100431591-100431613 GCCTCGCTGACTGCCAGCCGGGG + Exonic
1036508674 8:9380297-9380319 GTCTCGGTGACAGCCAGCTCGGG + Intergenic
1036820182 8:11933866-11933888 GCTGGGGTGACTGCCAACCCTGG + Intergenic
1042021872 8:64377815-64377837 GGCGCGATGACTGTAAGCGCAGG - Intergenic
1049411193 8:142474715-142474737 GCCGCGGGGACTGTCGGGGCAGG + Intronic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1055417450 9:76098885-76098907 GCCGCTGTGACTCCCATGGCAGG + Intronic
1057869208 9:98706194-98706216 GCCGCTGAGCCTGCCAGCTCAGG + Intronic
1059414724 9:114155784-114155806 GCCGCGCTGCCTGCCTGCTCGGG + Exonic
1061970420 9:134041878-134041900 GCCGCGGGGGCAGGCAGCGCCGG + Exonic
1062252036 9:135603117-135603139 GCTGCGGCGGCTGCCAGAGCAGG - Intergenic
1062570430 9:137182628-137182650 GCCACTGTGCCTGCCAGCCCCGG + Intronic
1203772288 EBV:55728-55750 GCCGCGGTGTCGGCCAGCGGTGG + Intergenic
1187226039 X:17375967-17375989 GCCGCCGCCACTGCCCGCGCCGG + Exonic
1187664564 X:21591070-21591092 GCCGTGGTGACTGTGAGGGCTGG + Exonic
1193603221 X:83534431-83534453 GTTGTGGTGACTGCCAGCTCAGG + Intergenic