ID: 948423863

View in Genome Browser
Species Human (GRCh38)
Location 2:237876104-237876126
Sequence CTGGAGCTGCCCCGATGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948423863_948423867 8 Left 948423863 2:237876104-237876126 CCGGCGCATCGGGGCAGCTCCAG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 948423867 2:237876135-237876157 CGTTTTACTCAGCAGTCCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 23
948423863_948423868 9 Left 948423863 2:237876104-237876126 CCGGCGCATCGGGGCAGCTCCAG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 948423868 2:237876136-237876158 GTTTTACTCAGCAGTCCGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 44
948423863_948423866 7 Left 948423863 2:237876104-237876126 CCGGCGCATCGGGGCAGCTCCAG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 948423866 2:237876134-237876156 GCGTTTTACTCAGCAGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948423863 Original CRISPR CTGGAGCTGCCCCGATGCGC CGG (reversed) Intronic
900557375 1:3287308-3287330 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557389 1:3287355-3287377 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557403 1:3287402-3287424 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557431 1:3287497-3287519 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900950410 1:5855428-5855450 ATGGAGGTGCCCCGATTCTCTGG - Intergenic
901217549 1:7563146-7563168 ATGGGGCTGCCCCGATGCCTGGG - Intronic
901854666 1:12037048-12037070 GTGGAGCTGGCCGGGTGCGCTGG + Intergenic
904438256 1:30513344-30513366 CTGGAGCTGTCCAGATCCTCAGG - Intergenic
916676349 1:167066881-167066903 CGCGTGCTGCCCCGAGGCGCGGG + Intronic
917617877 1:176764881-176764903 CTGGAGCAGGCCGGATGCGGTGG - Intronic
917929335 1:179812983-179813005 CTGGAACTGCCCCGAGGCTGGGG - Intronic
920200790 1:204258619-204258641 CTGGAGCTGCCCAAATCCCCAGG + Intronic
923629112 1:235638035-235638057 ATGAAGCTGGCCAGATGCGCAGG - Intronic
924708099 1:246514132-246514154 CTGGGGCTGCCCCAAAGCCCAGG - Intergenic
1070882519 10:79862068-79862090 CTGGAGGAGCCCCGATGGGAAGG - Intergenic
1072576357 10:96704242-96704264 CAGGAGCTGCCCTGATGTGATGG + Intronic
1075306034 10:121368067-121368089 CTGGAGATGCCCCTCTGTGCAGG + Intergenic
1076723274 10:132401979-132402001 CTGGAGCTGCCGCCCTGCCCAGG - Intronic
1077042204 11:529826-529848 CTGGAGCTGTGCTGATGGGCAGG - Intergenic
1077080841 11:724121-724143 CGGGAGCTGCCCTGATGACCAGG + Intronic
1077298588 11:1837271-1837293 CAGGGGCTGCCCCGAGGCCCGGG - Exonic
1078915286 11:15773027-15773049 CTGGAACTGCACAGATGGGCAGG + Intergenic
1083827575 11:65212050-65212072 CACGAGCTGCCCCCATGGGCCGG - Intergenic
1083987778 11:66227985-66228007 CTGGAGCTGCCCAGGAGTGCAGG + Intronic
1088363795 11:109018139-109018161 CCAGAGCTGCCAGGATGCGCTGG - Intergenic
1090807042 11:130209327-130209349 CTGGAACAGCCCAGATGCCCGGG - Intronic
1091407059 12:215569-215591 CTTGAGCTACCCCGGTGCTCAGG + Intergenic
1091450043 12:566702-566724 CTGGAGCTGCCGCCCTGCTCAGG + Intronic
1091750821 12:3020431-3020453 CTGGAGCTGCCCTGGTGGGGAGG - Intronic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1097950166 12:65418938-65418960 CTGGTGCTGCCCCTCTGCCCGGG + Intronic
1103779362 12:123389022-123389044 CCGGGGCTGCCGCGGTGCGCGGG + Intronic
1104588188 12:130064014-130064036 CTGGACCTGCCCAGATTCTCAGG + Intergenic
1105217451 13:18297508-18297530 CCGGGGCTGCCGCGGTGCGCGGG + Intergenic
1105719604 13:23100817-23100839 CTGGAGCTGCCACGGTACCCAGG + Intergenic
1108575518 13:51787041-51787063 ATGGAGCTGCCCCTCTGTGCTGG + Intronic
1113476085 13:110582332-110582354 CTGGACCTGCCCCGAGGTGCTGG + Intergenic
1119175501 14:72565258-72565280 CTGCAGCTGCCCTGATGCTGTGG - Intronic
1121741115 14:96252944-96252966 CTGGAGCTGCCTGAATGCCCAGG + Intronic
1128335860 15:66785468-66785490 CTGGAGCTCTCCCCATGCCCTGG + Intergenic
1130531185 15:84748698-84748720 CTGGGGCTGCCCCGGCCCGCAGG - Intronic
1132826864 16:1909503-1909525 CTGCAGCTGCCCTGAGGGGCAGG - Intergenic
1136314975 16:29449192-29449214 CTGGTGCTGCCCTCCTGCGCCGG - Intronic
1136655988 16:31709500-31709522 CTGGAGCTGCTCCAAGACGCTGG - Intergenic
1141798697 16:86292379-86292401 CAGGAGCTGCCCCGGGGCACGGG - Intergenic
1141983587 16:87565319-87565341 CTGGAGATGCCCCGCAGGGCTGG - Intergenic
1145265248 17:21376787-21376809 CGGGAGCTGCCCTGAGGCGGTGG + Exonic
1145760733 17:27424285-27424307 CTGGGGCTGCCCCAAAGCTCAGG + Intergenic
1146160788 17:30558544-30558566 CTGGGGCTGCCCCAAAGCCCGGG + Exonic
1146843594 17:36170261-36170283 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1146855901 17:36258199-36258221 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1146864719 17:36330176-36330198 CTGGGGCTGCCCCAAAGCCCAGG + Intronic
1146871807 17:36382110-36382132 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1146879168 17:36433192-36433214 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1147067580 17:37930770-37930792 CTGGGGCTGCCCCAAAGCCCAGG + Intronic
1147074694 17:37982734-37982756 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1147079109 17:38010325-38010347 CTGGGGCTGCCCCAAAGCCCAGG + Intronic
1147086217 17:38062273-38062295 CTGGGGCTGCCCCAAAGCCCAGG - Intronic
1147095048 17:38134267-38134289 CTGGGGCTGCCCCAAAGCCCAGG + Intergenic
1147102163 17:38186238-38186260 CTGGGGCTGCCCCAAAGCCCAGG - Intergenic
1147139310 17:38452490-38452512 CTGGAGCTGCCCCGCTTTCCTGG + Intronic
1149846752 17:60012749-60012771 CTGGGGCTGCCCCAAAGCCCAGG - Intergenic
1150085099 17:62269323-62269345 CTGGGGCTGCCCCAAAGCCCAGG - Intergenic
1150806615 17:68324453-68324475 CTGGAGCTGGGCCGGTCCGCAGG - Intronic
1151210223 17:72538917-72538939 CTAGAGGTGCCCTGCTGCGCTGG + Intergenic
1151890312 17:76947521-76947543 CTGGAGCTGCCTCGATGCTCAGG - Intronic
1153772768 18:8428840-8428862 CTGGAGCTGCCCTGAGGCAGAGG - Intergenic
1156268290 18:35508138-35508160 GTGGGGCTGGCCCGATGAGCTGG + Intergenic
1156479292 18:37426137-37426159 CTGGACCTGCCCCCAAGCACAGG + Intronic
1159948417 18:74460633-74460655 CTGCAGCTGCTCCAATGAGCGGG + Intergenic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
1163563994 19:18038861-18038883 CTGCTGCTGCCTCGCTGCGCTGG - Intergenic
1164792764 19:31002183-31002205 CTGGAGCTGCCCATATGGGGAGG + Intergenic
927719362 2:25373020-25373042 CTAGGGCTGCCCTGATGGGCTGG - Intergenic
934296869 2:91749175-91749197 CTGGGGCTGCCGCGGTGCGCGGG - Intergenic
934494105 2:94782592-94782614 CTGCAGCTGCCCTGATGGACAGG + Intergenic
934526779 2:95056940-95056962 CTGGAGCGGCCCTGGGGCGCTGG - Intergenic
941261852 2:163307255-163307277 CTGGAGCTGCTCTCATGGGCTGG - Intergenic
946164920 2:217858048-217858070 CTGGAGGTGCCCCAAAGCTCAGG + Intronic
948423863 2:237876104-237876126 CTGGAGCTGCCCCGATGCGCCGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172008596 20:31833660-31833682 CTGCAGCTGCCCCCCTGCCCTGG + Intronic
1173640934 20:44601385-44601407 CTGGATGTGCCCCAAGGCGCTGG + Intronic
1177387309 21:20425164-20425186 CTGGTGCTGCCCCTCTGCCCAGG + Intergenic
1177645858 21:23899267-23899289 CTGAAGCTGCCCTCATGGGCTGG + Intergenic
1178878016 21:36427551-36427573 CTGGAGCTTCTCCTATGCCCTGG - Intergenic
1180950083 22:19717015-19717037 CTGGAGCTGCCCCCTTTCCCTGG + Intronic
1180962066 22:19766593-19766615 GTGCAGCGGCTCCGATGCGCCGG - Exonic
1182528224 22:30934967-30934989 CTGGAGCAGCCTAGATGTGCTGG + Exonic
1183440214 22:37818708-37818730 CTGGCGTTGCCCTGCTGCGCTGG + Intergenic
1184065687 22:42118848-42118870 CAGTAGCTGCCCCTATGCGTGGG - Intergenic
1184523490 22:45008803-45008825 CGCGAGCTGCCCCGATGAGGCGG - Intronic
1185105140 22:48864519-48864541 CAGCAGCTGCCCCCATGCCCCGG + Intergenic
1185284741 22:49995197-49995219 CTGGAGCTTCCCCAGTGCTCTGG - Exonic
949965564 3:9353138-9353160 CTGCAGCTGCCCCTTTGTGCAGG + Intronic
950173172 3:10853196-10853218 CTGGAGCTGCCCAGACTTGCTGG - Intronic
950377486 3:12583812-12583834 CAGGAGCTGCCCCTATGGGGCGG - Exonic
954392476 3:50274891-50274913 CAGGAGCAGCCCCTCTGCGCTGG - Exonic
954866024 3:53730635-53730657 CTGCAGCTGCCGTGATGCGGGGG - Intronic
959512156 3:107225821-107225843 CTGGGTCTGCCCGGATGCACAGG + Intergenic
960674003 3:120177410-120177432 CTGGCGCTGCCTCGCTGCCCTGG + Intronic
965206261 3:165721276-165721298 CTGCAGCTGCCCAGTTGCCCTGG - Intergenic
966898833 3:184465968-184465990 CTGGAGCCGCCCCACTGGGCTGG - Intronic
969321664 4:6416640-6416662 CTGCAGCCACCCCGATGCGCTGG + Intronic
978189659 4:105896438-105896460 CCGGAGCGGCCCCGGAGCGCGGG - Intronic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
998041063 5:138951377-138951399 CTGGACCTGCCCTGAGGCCCAGG + Intronic
1001241632 5:170075865-170075887 CTGCAGCTGCCTTGATGGGCGGG + Intronic
1001250152 5:170140875-170140897 CTGGAGCTGCCCCTCTGCCCAGG + Intergenic
1006300234 6:33190223-33190245 CTGAAGCTGCCACGAGGAGCCGG + Intronic
1006452071 6:34111016-34111038 CTGGAGCTGCCCCCAAGCCTTGG - Intronic
1006738501 6:36291814-36291836 CTGGAGCTTCCCAGAGGCCCAGG + Intronic
1007432727 6:41786139-41786161 CTGGCGCTGCACCGAGGCGGAGG + Exonic
1008378769 6:50820242-50820264 CAGGAGCTGTCCCGATCCGGAGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1018957137 6:168417839-168417861 CTGGACATGCTCCGAAGCGCGGG + Intergenic
1019433027 7:1008064-1008086 CTGGACCTGCCCTGATGCCTGGG - Intronic
1022995367 7:35749864-35749886 CTGGAGCTTCCCCACTGAGCTGG + Intergenic
1029736320 7:102467801-102467823 CTGGAGCTGCCCACAAGCCCAGG + Exonic
1033640993 7:143263346-143263368 CTGGCCCTGCCCCGCTGCGCCGG + Intronic
1037835895 8:22214525-22214547 GTGCAGCTGCCCCTCTGCGCAGG + Intergenic
1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG + Intronic
1042484376 8:69334496-69334518 CTGGAGCAGCCCCGACTCACAGG + Intergenic
1049352682 8:142172403-142172425 GTGGAGCCGCCCTGATGTGCAGG - Intergenic
1049371671 8:142270964-142270986 CTGGAGTTGTCCCGGTGCCCTGG + Intronic
1049548042 8:143243724-143243746 CTGGAGCTGCCCGGAAGCCCAGG - Intergenic
1052611107 9:30774496-30774518 CTGGCGCTACCCCTCTGCGCGGG - Intergenic
1053004377 9:34594299-34594321 CCGGAGCTGTCCCGAGGCCCAGG + Intergenic
1060403877 9:123363294-123363316 CTAGAGCTGCCCGGATGCCTGGG - Intronic
1061208698 9:129178476-129178498 CTGGGGCTGCCGCGCCGCGCGGG + Intergenic
1062339281 9:136086757-136086779 CTGGAGCTGGCCAGCTGCACTGG + Intronic
1194879515 X:99234630-99234652 CTGGAGCTGTTCCTATTCGCTGG - Intergenic