ID: 948424075

View in Genome Browser
Species Human (GRCh38)
Location 2:237876873-237876895
Sequence GTTCCACGGGTACCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948424075_948424085 3 Left 948424075 2:237876873-237876895 CCATCCCCAGGTACCCGTGGAAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 948424085 2:237876899-237876921 GGCAGCCAGAGACTGTCTCCGGG 0: 1
1: 0
2: 5
3: 23
4: 265
948424075_948424091 28 Left 948424075 2:237876873-237876895 CCATCCCCAGGTACCCGTGGAAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 948424091 2:237876924-237876946 CCTCTCATGCTGCCCATGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 292
948424075_948424084 2 Left 948424075 2:237876873-237876895 CCATCCCCAGGTACCCGTGGAAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 948424084 2:237876898-237876920 GGGCAGCCAGAGACTGTCTCCGG 0: 1
1: 0
2: 2
3: 24
4: 239
948424075_948424093 30 Left 948424075 2:237876873-237876895 CCATCCCCAGGTACCCGTGGAAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 948424093 2:237876926-237876948 TCTCATGCTGCCCATGCCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 213
948424075_948424092 29 Left 948424075 2:237876873-237876895 CCATCCCCAGGTACCCGTGGAAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 948424092 2:237876925-237876947 CTCTCATGCTGCCCATGCCTGGG 0: 1
1: 1
2: 2
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948424075 Original CRISPR GTTCCACGGGTACCTGGGGA TGG (reversed) Intronic
900497265 1:2981487-2981509 GGTCCATGGTCACCTGGGGAAGG - Intergenic
900542914 1:3212938-3212960 CTTAAACGAGTACCTGGGGAGGG - Intronic
902204767 1:14860066-14860088 GTTGCAATGGTACCTGGAGAAGG - Intronic
904055152 1:27665120-27665142 GTCCCAAGGGATCCTGGGGAAGG + Intergenic
907552907 1:55319372-55319394 ATTCCATGGATAACTGGGGAAGG - Intergenic
910554784 1:88519421-88519443 GTTCCAAGGGAAACTGGGTAGGG - Intergenic
915244973 1:154550394-154550416 GGTCCAGTGGTGCCTGGGGAGGG + Exonic
916245015 1:162678674-162678696 GATACAAGGTTACCTGGGGAAGG - Intronic
919194870 1:194271383-194271405 ATTCCCCTGGTACCTGGGGAAGG + Intergenic
919776682 1:201198814-201198836 GTTGCAAGGGAAGCTGGGGAAGG + Intronic
920191606 1:204197337-204197359 GTGCCAAGGGTACAGGGGGAAGG - Intergenic
923576195 1:235161140-235161162 GCGGCACGAGTACCTGGGGAGGG - Intronic
1063024899 10:2168217-2168239 GATCCAGGGGTGCCTGGGAACGG + Intergenic
1064933068 10:20649235-20649257 GATACAGAGGTACCTGGGGAGGG - Intergenic
1068221474 10:54051519-54051541 GTTCCACAGGTATCTGGGGTAGG - Intronic
1069860685 10:71469309-71469331 GCTCCAAGGTTGCCTGGGGAAGG - Intronic
1073057904 10:100713945-100713967 GTTAAACGGGGACCTGGGGAGGG - Intergenic
1075025654 10:118981345-118981367 GGGCCAGGGGTACCTGGGGGTGG + Intergenic
1075569541 10:123529683-123529705 GTTCCAGGGCTGCCTGGGTAGGG - Intergenic
1076855507 10:133113838-133113860 GGTCCACAGGGACATGGGGAAGG - Intronic
1077210977 11:1370833-1370855 GCTCCACAGTCACCTGGGGACGG - Intergenic
1083159824 11:60848130-60848152 CCTCCACGGGTGCCTGGGGGAGG + Intronic
1084935422 11:72584236-72584258 GTTCGACGAGGACCTGGCGACGG - Exonic
1088714555 11:112537433-112537455 GTTCCACAGGTAGATGGGGAAGG + Intergenic
1089627178 11:119758821-119758843 GGTCCACTGGTGCCTGGGGATGG - Intergenic
1089638914 11:119834114-119834136 GGACCAAGGGTAACTGGGGAGGG - Intergenic
1092821681 12:12358765-12358787 TTTCCTCTGGTATCTGGGGAAGG + Intronic
1092894683 12:13000565-13000587 TTTCCGCGGGTGTCTGGGGAGGG + Intergenic
1094176681 12:27548320-27548342 CTTCCAGGGGGCCCTGGGGATGG + Intronic
1099838361 12:87936451-87936473 GTTCCACAGATCTCTGGGGAAGG - Intergenic
1101721969 12:107358329-107358351 GCTCCACAGATACCTGGAGAAGG + Intronic
1103235188 12:119366754-119366776 ATCCCACGGGTACATGGGGTGGG - Intronic
1105541300 13:21319600-21319622 GACCCACGGGTACCTGAGCATGG + Intergenic
1105767690 13:23578114-23578136 GATCCAGGTGTAGCTGGGGAAGG + Intronic
1111008576 13:82282157-82282179 GTTCCACAGATCCCTAGGGAAGG + Intergenic
1111263116 13:85769751-85769773 GTTCCAAGGGTATCTGGTGAAGG + Intergenic
1112629030 13:101140220-101140242 ATTCCAACTGTACCTGGGGAGGG + Intronic
1112636953 13:101226488-101226510 TTTCCATGGGAACATGGGGATGG - Intronic
1117042789 14:51782075-51782097 GATCAACGGTTGCCTGGGGATGG - Intergenic
1117985094 14:61379211-61379233 TTTCCAAGTGGACCTGGGGAGGG - Intronic
1120270588 14:82309091-82309113 GTTCCACAGATCTCTGGGGAAGG - Intergenic
1122999623 14:105286323-105286345 CTTCCACGTGAATCTGGGGAAGG - Exonic
1123105918 14:105840977-105840999 GTTCCACAAGGACCTGGGCAGGG + Intergenic
1124509153 15:30307429-30307451 GTTCCACAGGTCTCTAGGGAAGG + Intergenic
1124734406 15:32231233-32231255 GTTCCACAGGTCTCTAGGGAAGG - Intergenic
1125538558 15:40456824-40456846 GTTGCAGGAGTACCTGGTGAGGG + Intronic
1133536988 16:6711829-6711851 GACCTAGGGGTACCTGGGGAAGG - Intronic
1135666898 16:24343497-24343519 GTCCCAGGGGCACCTGGGCAGGG - Intronic
1138457719 16:57130961-57130983 GAACCACGGGCACCAGGGGAGGG + Intronic
1143632355 17:8146490-8146512 GCTCTCCAGGTACCTGGGGATGG + Exonic
1145057904 17:19715148-19715170 GTTCTGCGGGCACCTGGGCAAGG - Exonic
1148971844 17:51490595-51490617 GTTCCCTGGGTACCAGGGCACGG - Intergenic
1152780771 17:82226609-82226631 GCTCCAGGGGCACCTGGGCACGG - Intergenic
1159445279 18:68534999-68535021 GCTCCACGGGTGCCTGGGCCGGG + Intergenic
1160733954 19:653355-653377 GCTCTAGGGGGACCTGGGGATGG - Intronic
1161021926 19:2014870-2014892 GATCCAGGGGGGCCTGGGGATGG + Intronic
1161719571 19:5895469-5895491 GTTCCAGTGGGAGCTGGGGAGGG + Intronic
1162523243 19:11194030-11194052 GGGCCAGGGGTCCCTGGGGATGG + Exonic
1162826738 19:13257246-13257268 TTTCTAGGGGTACCTGGGGGAGG - Intronic
1163761971 19:19142210-19142232 CTGCCACGGGAGCCTGGGGAGGG + Intergenic
1166300207 19:41908603-41908625 GTTCCAGGGGTACTCAGGGAAGG + Intronic
1166664804 19:44672726-44672748 CTTCAACTGGTACCTGGGGGAGG + Exonic
1167049464 19:47069472-47069494 GTTCCCCTGAGACCTGGGGAGGG - Intronic
1167126105 19:47549762-47549784 GTTCCAAGAGTACCAGGTGATGG - Intronic
1167550103 19:50154561-50154583 GTTCCACGGGGGACTGAGGAGGG + Intronic
925907184 2:8546410-8546432 GCTCCACTGGGGCCTGGGGAGGG + Intergenic
926800257 2:16653727-16653749 ATTTGACGGGGACCTGGGGAAGG + Intronic
931667578 2:64621393-64621415 GTTGCCCGGGTTCCTGGGGAGGG + Intergenic
932581250 2:72993990-72994012 GCTCTCAGGGTACCTGGGGAAGG + Intronic
941525256 2:166598597-166598619 GTTCCACAGATCCCTAGGGAAGG + Intergenic
945365183 2:208944230-208944252 TATCCACTGGTACCTGTGGAAGG + Intergenic
948424075 2:237876873-237876895 GTTCCACGGGTACCTGGGGATGG - Intronic
948748075 2:240110122-240110144 ATTCCATGTGCACCTGGGGAAGG - Intergenic
1171199985 20:23233095-23233117 GTGCCACGGGGACGTGGAGAGGG - Intergenic
1172619937 20:36312107-36312129 GGTTCACGGGTACCAAGGGATGG + Intronic
1176602475 21:8806228-8806250 CTCCCACAGGAACCTGGGGATGG + Intergenic
1180092950 21:45542153-45542175 GGTCCGCGGGGCCCTGGGGAGGG - Intronic
1180092975 21:45542214-45542236 GGTCCGCGGGGCCCTGGGGAGGG - Intronic
1180344760 22:11697781-11697803 CTCCCACAGGAACCTGGGGATGG + Intergenic
1180617555 22:17138299-17138321 GTTCCACCAGTACCTGCAGAAGG - Exonic
1182554101 22:31119708-31119730 TTTCCAGGGGCACCTGAGGATGG - Intronic
1184850260 22:47115722-47115744 GTGCCACGTGTGCCTGAGGAGGG - Intronic
1184912407 22:47544965-47544987 CTTGCAGGGGGACCTGGGGAAGG + Intergenic
950044954 3:9943572-9943594 CTGCCACTGCTACCTGGGGAAGG - Intronic
954333615 3:49903747-49903769 GTTTCACAGGAACCTGGGGCGGG - Intronic
956461210 3:69474444-69474466 GTTCCAAGGGGAATTGGGGATGG + Intronic
962494527 3:135925915-135925937 GTTCCACCAGTAGCTGGGGCAGG - Intergenic
965074864 3:163963492-163963514 GTTCCACAGATCCCTGGGGCAGG - Intergenic
969302807 4:6307226-6307248 TATCCAGGGGTACCTGGGCACGG + Intergenic
969415338 4:7054133-7054155 CATCCACGGGAACCTGGGGAAGG + Exonic
970347288 4:15164949-15164971 ATTCCATGGGTACCTGGAGAAGG + Intergenic
971585045 4:28394698-28394720 GTTCCAAAGGTTCCGGGGGAGGG - Intronic
972012774 4:34205589-34205611 GTTCCACAGGTCTCTGGGGCAGG - Intergenic
972600201 4:40565411-40565433 GGTCCTTGGGTTCCTGGGGAAGG + Intronic
973232161 4:47853530-47853552 TTCCCAAGGGAACCTGGGGAAGG + Intronic
979703131 4:123689952-123689974 GTTCCACAGGTCCCTGGGAAGGG + Intergenic
985975568 5:3416886-3416908 GTTCCAAGGGTTCCTGTTGAAGG + Intergenic
988456288 5:31389874-31389896 GTTCCACAGGTCCCTAGGGTAGG + Intergenic
993067192 5:83114462-83114484 GTTCCACAGATCTCTGGGGAAGG + Intronic
994174051 5:96691556-96691578 GTTCCATTGCTACCTGGGCAAGG + Intronic
995082246 5:108065957-108065979 GGTACATGAGTACCTGGGGAAGG + Intronic
1000715429 5:164637873-164637895 CTGCCACAGGTACCTAGGGAAGG + Intergenic
1002869741 6:1156295-1156317 GTTCCACGGATCCCTAGGGAAGG - Intergenic
1011625971 6:89284166-89284188 GTACCAAGGGTACCTTGGGAGGG + Intronic
1014040851 6:116823320-116823342 GTTCCACAGATCCCTGGGCAGGG + Intronic
1018962225 6:168457147-168457169 CTTCCACGGTCACCTGGAGATGG + Intronic
1019198467 6:170296001-170296023 GATCCGCGGGTTCCAGGGGAAGG - Intronic
1023038758 7:36154353-36154375 GTCCGAGGGGTCCCTGGGGATGG - Exonic
1025093405 7:56080923-56080945 GTTCCAGGGGTTCCTGGCCAGGG + Exonic
1027913066 7:84278158-84278180 GTTCCACAGGTCCCTAGGGCAGG + Intronic
1035027541 7:155835890-155835912 GTGTCACAGGTGCCTGGGGAGGG - Intergenic
1035743325 8:1944905-1944927 GTCCCACGGGTGCCTGGGCCTGG - Intronic
1035864798 8:3070520-3070542 GTTCCACAGATCCCTAGGGAAGG + Intronic
1039810575 8:41044381-41044403 CTCACAGGGGTACCTGGGGAGGG - Intergenic
1040741269 8:50579240-50579262 GTTCCACAGATCTCTGGGGAGGG - Intronic
1041682135 8:60604651-60604673 GTTCCACAGGTCCCTAGGGCAGG - Intronic
1045284883 8:100781900-100781922 GTTCAAAGGGTGCATGGGGAAGG - Intergenic
1045670979 8:104553111-104553133 CTTCCAGGGGTCCTTGGGGAGGG + Intronic
1049423058 8:142525305-142525327 GTACCCCAGGCACCTGGGGATGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1057325794 9:94062168-94062190 GTTCCACAGATACCTAGGGCAGG + Intronic
1060231151 9:121826690-121826712 GTGCCAAGGGTGCCTGAGGATGG + Intronic
1060295711 9:122341514-122341536 GTTTCAGGGGCCCCTGGGGATGG - Intergenic
1060404431 9:123366217-123366239 GTCGCACCGGAACCTGGGGAGGG - Exonic
1060965348 9:127709412-127709434 CTTCCGCTGGTACCTGGGGCAGG - Exonic
1062344024 9:136106648-136106670 GCCCCACGGGTTCCTGGGGCTGG - Intergenic
1062569632 9:137179146-137179168 CTTCCTGGGGTACCTGGGGTTGG + Intronic
1189865902 X:45326752-45326774 GTTCCACTGTTAGCTGAGGAAGG - Intergenic
1190736979 X:53262218-53262240 GTTCCACAGGGATCTGGGGCTGG + Intronic
1191900487 X:66035127-66035149 GTTCTAAGGGTCCCTGGTGAGGG - Intronic
1192905011 X:75542076-75542098 GTTCCACGGATATTTGGGGAAGG + Intergenic
1194360406 X:92942653-92942675 GTTCCACGGATACCTAGAGCAGG + Intergenic
1196466457 X:115976555-115976577 GCTCCATGGATATCTGGGGATGG + Intergenic
1196930492 X:120676623-120676645 GTTCCACAGATATCTAGGGAAGG + Intergenic