ID: 948427003

View in Genome Browser
Species Human (GRCh38)
Location 2:237894718-237894740
Sequence AAAAGCCACCTGGACAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948427003_948427007 -9 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427007 2:237894732-237894754 GTGGCTTTTGAACTGTGGAGAGG 0: 1
1: 0
2: 2
3: 43
4: 324
948427003_948427008 -2 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427008 2:237894739-237894761 TTGAACTGTGGAGAGGCCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 172
948427003_948427015 26 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427015 2:237894767-237894789 TGGAACCTTCTCCCTTGCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 186
948427003_948427009 2 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427009 2:237894743-237894765 ACTGTGGAGAGGCCCCTGGACGG 0: 1
1: 0
2: 1
3: 27
4: 282
948427003_948427014 25 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427014 2:237894766-237894788 CTGGAACCTTCTCCCTTGCTCGG 0: 1
1: 0
2: 0
3: 14
4: 187
948427003_948427010 6 Left 948427003 2:237894718-237894740 CCCAGGCTGTCCAGGTGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 948427010 2:237894747-237894769 TGGAGAGGCCCCTGGACGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948427003 Original CRISPR AAAAGCCACCTGGACAGCCT GGG (reversed) Intronic
900198159 1:1387923-1387945 GACAGCCACCTGGGCAGCCCTGG + Intronic
901180857 1:7340988-7341010 AAAAGCACCCTGGCCAGCCCAGG - Intronic
901630117 1:10643813-10643835 AGAAGACACCTGGCCGGCCTGGG - Intronic
902389249 1:16093077-16093099 ACATGCCACCTGGACCTCCTAGG - Intergenic
902691858 1:18114986-18115008 AACACCCACCTGGACAGCAGTGG - Intronic
903235673 1:21949146-21949168 AAACGGCACCTGGTTAGCCTGGG + Intergenic
903926359 1:26833576-26833598 AAGGGCCACCTGGGCTGCCTGGG - Intronic
904259539 1:29280399-29280421 AAAGGCCCCCTGGACAGGCCTGG - Intronic
904327887 1:29739259-29739281 GAAAGCCACCTGGAGACCCAAGG + Intergenic
905987126 1:42295815-42295837 AAAAGACACCTGGACAGGTGCGG - Intronic
907270081 1:53285886-53285908 AAAAGCCCCCTTGCCAGCTTTGG - Intronic
909342099 1:74543667-74543689 AAATGCCACCTGGCCAGCTTGGG + Intronic
913100353 1:115558342-115558364 AACAGGTACCTGGACAGCGTTGG + Intergenic
913698818 1:121354691-121354713 GAAATCTACCTGGACTGCCTGGG - Intronic
914138727 1:144925346-144925368 GAAATCTACCTGGACTGCCTGGG + Intronic
915130593 1:153693133-153693155 AAACTCCTCCAGGACAGCCTTGG - Exonic
916025704 1:160831695-160831717 TAAAGCCAACTGGACAACCCAGG - Intronic
917025709 1:170639189-170639211 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917675900 1:177319386-177319408 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917676720 1:177325460-177325482 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917840771 1:178975545-178975567 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
918117324 1:181508531-181508553 ATAAGCCTTCTGAACAGCCTAGG - Intronic
919062051 1:192645695-192645717 TAAAGGCACCTGGATAGCCATGG + Intronic
920486227 1:206373389-206373411 GAAATCTACCTGGACTGCCTGGG - Intronic
923097795 1:230789223-230789245 TAAAGTCACCTGGGCATCCTGGG + Intronic
924116014 1:240747842-240747864 AAAAAACATCTGGACAGCCAAGG + Intergenic
1070415605 10:76186511-76186533 TATTGCCACCAGGACAGCCTGGG - Intronic
1071061765 10:81578404-81578426 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1072844916 10:98818785-98818807 AAAAGCCACTTGGATAGATTTGG - Intronic
1072930042 10:99654450-99654472 AGATTACACCTGGACAGCCTGGG + Intergenic
1073047237 10:100646811-100646833 AAATGTCACCTGGACACACTTGG + Intergenic
1073186474 10:101618254-101618276 AAGGGCCACCTGGTCAGCCATGG - Intronic
1073321888 10:102620649-102620671 AAGAGCCTCCTGCACAGCCCCGG - Intronic
1074284843 10:112088447-112088469 AGGAGCCACCAGGACAGCCCTGG + Intergenic
1074782583 10:116812608-116812630 AAAAGCCTCCTGTACAGCACTGG + Intergenic
1076452399 10:130565659-130565681 AAACACCACATAGACAGCCTGGG - Intergenic
1076794275 10:132791193-132791215 CCACCCCACCTGGACAGCCTCGG - Intergenic
1076906870 10:133366845-133366867 AAGAGCCACCTGGAAACCCGGGG - Intronic
1080294693 11:30713211-30713233 ATAAGCAGCCTGGACTGCCTTGG + Intergenic
1081658340 11:44872849-44872871 AAGTGCCACCTGCCCAGCCTGGG + Intronic
1081991451 11:47339760-47339782 AAGATCCACCTGGACTGCCCAGG - Exonic
1082036090 11:47646478-47646500 AAGACCAGCCTGGACAGCCTTGG - Intergenic
1083209586 11:61174775-61174797 AAAACCCACCGGGAAAGCCTGGG - Intergenic
1083775645 11:64893289-64893311 GAAAGGGACCTGGACAGCCATGG - Intergenic
1084068957 11:66721423-66721445 GGAAGCCACCTGGGAAGCCTGGG + Exonic
1084253210 11:67918912-67918934 AAAAGCCTCCTGCACAGCATAGG - Intergenic
1084358463 11:68654305-68654327 CAATGGCACCTGGACAGCCTGGG + Intergenic
1084819669 11:71677019-71677041 AAAAGCCTCCTGCACAGCATAGG + Intergenic
1084883945 11:72191164-72191186 GACAGCCAGCTGGACAGCCCTGG - Intronic
1085035307 11:73296500-73296522 GAAACCCACCTGGGCAGCCATGG + Exonic
1085746051 11:79115268-79115290 AGAAGCAACCTGCCCAGCCTGGG + Intronic
1089453886 11:118614613-118614635 AAACCCCACCTGGTGAGCCTGGG + Exonic
1090093995 11:123725914-123725936 AAAAGCCCTCTTGTCAGCCTGGG - Exonic
1091530494 12:1350325-1350347 TCAGGACACCTGGACAGCCTTGG - Intronic
1092423453 12:8353736-8353758 AAAAGCCTCCTGCACAGCAAAGG - Intergenic
1092872221 12:12815680-12815702 AAAAGCCAACTGGAAAACATGGG + Intronic
1093491300 12:19707737-19707759 AGAAGCCAGCTGGACTTCCTGGG - Intronic
1094469918 12:30794323-30794345 AAAAGGCATTTGGACAGCCCTGG - Intergenic
1095471464 12:42541713-42541735 GACAGTCACCTGGCCAGCCTTGG - Intronic
1097332848 12:58351152-58351174 AAAAGTTCCCTGGCCAGCCTGGG + Intergenic
1099375923 12:81896403-81896425 TAAAGCCAGCTGGACTCCCTGGG + Intergenic
1100859260 12:98787307-98787329 AAAAGCCATCCTGTCAGCCTGGG - Intronic
1100913411 12:99390815-99390837 GAAAGCCAACTGGACTGCCCTGG + Intronic
1101511096 12:105393106-105393128 AACAGCAACCTGGAGAGCTTGGG - Intronic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1102254475 12:111407565-111407587 AGAGGCCACCTGGGCAGGCTGGG + Intronic
1104603384 12:130169054-130169076 AAAAGCCACTTGGCCAGTGTGGG + Intergenic
1104910865 12:132240367-132240389 ACCAGCCACCTGGCCAGCATGGG - Intronic
1105998368 13:25694525-25694547 AAATGCCAGCTTGGCAGCCTGGG - Intronic
1106178468 13:27351213-27351235 TGAAGCCACCTGGACTTCCTGGG - Intergenic
1106865276 13:33957835-33957857 AGCTGCCACCTGGCCAGCCTGGG - Intronic
1107088614 13:36451753-36451775 AAAAGCCACCTCGAAATCCTAGG + Intergenic
1107132213 13:36908990-36909012 ATAAGCCACTTGGGAAGCCTTGG + Intronic
1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG + Intergenic
1113204278 13:107897601-107897623 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1113921503 13:113915656-113915678 AGAAGCCACTGGGACAGCCTGGG - Intergenic
1115093216 14:29603595-29603617 AAAAGTCACATGGACCACCTTGG - Intronic
1116799589 14:49429163-49429185 AAAGGCCACCTGGACATTTTTGG + Intergenic
1117771227 14:59136314-59136336 AATCGCCACCTTCACAGCCTTGG + Intergenic
1117909378 14:60622153-60622175 GTAAGCCACCTTGCCAGCCTTGG + Intergenic
1118572777 14:67210384-67210406 GAAACCCACCTGGACAACATAGG + Intronic
1119193886 14:72702761-72702783 AAAAGCCACCTGCTCAGACTGGG + Intronic
1121341783 14:93109729-93109751 AAAGGCCACCAGGCAAGCCTGGG + Intronic
1121967508 14:98324187-98324209 ACAAGCTATGTGGACAGCCTGGG + Intergenic
1122421556 14:101580978-101581000 AAAATCCTGGTGGACAGCCTAGG - Intergenic
1124696973 15:31871139-31871161 AACTGCAGCCTGGACAGCCTGGG - Intergenic
1125140639 15:36402728-36402750 AAAAGCCACCATACCAGCCTGGG - Intergenic
1125507746 15:40276798-40276820 GAAAGCCACCTTGACAGCCCAGG + Exonic
1126886889 15:53160250-53160272 AGAAGCCACCTGAGCAGCATGGG - Intergenic
1127550991 15:60038236-60038258 AAACGCCACCTGGGAAGCCCTGG + Intronic
1130063765 15:80588284-80588306 AAAAGCCAGCTGGAGAGCAGTGG - Intronic
1131719466 15:95151702-95151724 AAAAGCTACCTGGAAAACCCGGG + Intergenic
1131875069 15:96797056-96797078 ATAAGCGACCTCGACAGTCTCGG - Intergenic
1133047990 16:3099795-3099817 AAAAGCCACCTGGCAGGACTTGG - Intergenic
1133072018 16:3253015-3253037 AATTGTCACCTGGATAGCCTCGG + Intronic
1133374839 16:5276200-5276222 AAAAGCCTCCTGCACAGCAAAGG + Intergenic
1133593159 16:7265737-7265759 AAAAGACACCTGGCCAGGCATGG - Intronic
1133609354 16:7418395-7418417 AAAAGTCTCCTGGACACCATGGG - Intronic
1137628524 16:49924650-49924672 CATAGCTCCCTGGACAGCCTGGG + Intergenic
1137673834 16:50294048-50294070 AAAAGGCAGCGGGCCAGCCTTGG - Intronic
1137744230 16:50809232-50809254 AAAAGAGACCTGGCCATCCTGGG + Intergenic
1137755630 16:50899899-50899921 AACAGCCACAGGGAGAGCCTTGG - Intergenic
1138188841 16:54997993-54998015 GAAAGCCACTTGGACAGACCAGG - Intergenic
1138435768 16:56999296-56999318 GAAAGCAAAATGGACAGCCTTGG - Intronic
1138493906 16:57395437-57395459 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1138811788 16:60159439-60159461 ATGAGCCACCTGCCCAGCCTGGG - Intergenic
1139790406 16:69429536-69429558 CAAAGCCAGCTGGACTTCCTGGG - Intronic
1141499695 16:84435533-84435555 AACAGCCACCTGGCCAAGCTTGG + Intronic
1142052535 16:87968143-87968165 AAAAGCCACCCAGCCAACCTTGG - Intronic
1142365003 16:89645555-89645577 AAATACCACCAGGACAGCGTTGG + Exonic
1142730375 17:1850611-1850633 ATGAGCCACCAGCACAGCCTAGG - Intronic
1145112378 17:20175031-20175053 CAGAGGCCCCTGGACAGCCTGGG + Intronic
1145289859 17:21534527-21534549 AGAAGCCACAAGGACAGCCAAGG + Exonic
1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG + Intergenic
1146311431 17:31771342-31771364 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1146413502 17:32610272-32610294 TAAAGCCACCTAGACAGCAAGGG - Intronic
1146958735 17:36954047-36954069 AAAAGCAACTTGGAAAGCCAAGG - Intronic
1147042674 17:37730559-37730581 CAAAGCCACCAAGACAGGCTCGG - Intronic
1148075740 17:44934371-44934393 CTTGGCCACCTGGACAGCCTGGG + Exonic
1149322862 17:55499118-55499140 AAAAGACACCAGGACAGAGTTGG - Intergenic
1149603007 17:57905086-57905108 AAAGGCCACCTGTAAAGCCAGGG - Intronic
1151234201 17:72706815-72706837 AACAGCTACCTGAAGAGCCTGGG + Intronic
1151269985 17:72986588-72986610 ATCAGCCACCTTGACAGCTTGGG + Intronic
1152603625 17:81277956-81277978 CATGGCCACCTGGACACCCTAGG - Intronic
1153132799 18:1876704-1876726 AACATCCACATGGACATCCTAGG + Intergenic
1156792598 18:40994033-40994055 AAAAAACACATGGACAGTCTAGG - Intergenic
1157230388 18:45910195-45910217 TAAAGCCTGCTAGACAGCCTGGG - Intronic
1157474304 18:48011614-48011636 AAAAGCCACTAGGATAGACTGGG - Intergenic
1158396804 18:57085484-57085506 AAAGGCCACCTGGATTGCCCAGG + Intergenic
1160251069 18:77203936-77203958 TAAAGCGACATGAACAGCCTGGG - Intergenic
1162958749 19:14113983-14114005 AAACGCCTCCTGTACAGCCCCGG - Intronic
1163062118 19:14768330-14768352 AAAAGGCACCTTCACAGCCCTGG - Intronic
1163141295 19:15350642-15350664 AAAAATCACCTGGACAGGCCAGG - Intergenic
1163367576 19:16884317-16884339 AGAAGCCACATGGGCAGGCTGGG - Intergenic
1163611342 19:18303477-18303499 CAAGGCCAGCTGGTCAGCCTAGG + Intergenic
1165944575 19:39434139-39434161 AAAAGGCACCTGAACAGTCCAGG - Intronic
1167675806 19:50884531-50884553 AAAATCCACCTGGACTGCTCTGG - Intergenic
1168102938 19:54150571-54150593 CACTGCCTCCTGGACAGCCTGGG - Intronic
1168102944 19:54150600-54150622 CACTGCCTCCTGGACAGCCTGGG - Intronic
1168120567 19:54250650-54250672 AAAGACCACCAGGACATCCTGGG - Exonic
1168604173 19:57745000-57745022 AAACCCCACCTGGAATGCCTAGG + Intronic
1168660806 19:58164552-58164574 ATCAGCCACCTGGAGAGACTGGG + Intergenic
925853407 2:8106158-8106180 AAAATGAACCTGGACATCCTGGG + Intergenic
928023629 2:27722451-27722473 AAAAGGCACCTGCTCTGCCTTGG + Intergenic
928833643 2:35518247-35518269 GAAAGCCACCTTGACACCCATGG - Intergenic
932518853 2:72386044-72386066 AAAAGACACCTGCACTGCCATGG + Intronic
933344895 2:81071008-81071030 AAAAGTCAGATGGAAAGCCTAGG + Intergenic
935313060 2:101804534-101804556 AAAAGACCCCTGGACATGCTGGG - Intronic
937021922 2:118665102-118665124 AGAAGCCACATGGACAACCAGGG + Intergenic
937668371 2:124512997-124513019 ACAAGGCACCTGGCCTGCCTTGG - Intronic
937792828 2:125980549-125980571 AAAAGCCACCTGCTCATTCTGGG - Intergenic
938558424 2:132447913-132447935 GAAAACCACCTTGACAGCTTTGG + Intronic
938712389 2:133986653-133986675 AAAAGCCTCCAGGACAGTGTTGG + Intergenic
941116753 2:161480523-161480545 CAAAGCCGCTTGGCCAGCCTGGG - Intronic
941304893 2:163851506-163851528 AAAAATTACCTGGGCAGCCTGGG + Intergenic
943786668 2:191885154-191885176 TAAGGCCTCCTGGACAACCTTGG - Intergenic
944021425 2:195109744-195109766 AAAAAAAACCTGGTCAGCCTTGG + Intergenic
944110818 2:196129942-196129964 AAGAGACACTTGGACAGCTTGGG - Intergenic
944111008 2:196131267-196131289 AAGAGACACTTGGACAGCTTGGG - Intergenic
946074370 2:217061789-217061811 CAAAGTCACCTGGACAGGCCTGG + Intergenic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
948658341 2:239490883-239490905 AAACGCCACCTTTACAGCATTGG - Intergenic
949038946 2:241836305-241836327 CAAAGCCAGCTGGACTTCCTGGG - Intergenic
1169189221 20:3646813-3646835 AGCAGCCCCCTGCACAGCCTGGG + Exonic
1171503912 20:25617861-25617883 AAAAGCCACATAAAGAGCCTTGG - Intronic
1173242717 20:41312066-41312088 TAAAGCCAGCTGGACTTCCTGGG + Intronic
1173730047 20:45321939-45321961 AACAGCCTCCTAGACAGGCTTGG + Intergenic
1174405176 20:50298284-50298306 AAAAGACACAAGGACACCCTTGG - Intergenic
1181171664 22:21013390-21013412 AAAAGAAAGCTGGACAACCTGGG + Intronic
1181177689 22:21047129-21047151 AAAAGAAAGCTGGACAACCTGGG - Intronic
1181264371 22:21622125-21622147 AAAAGCCACCAGGACCGCCAGGG - Exonic
1182158984 22:28103129-28103151 AAAAGCCCCCTGGATAGACATGG + Intronic
1182853954 22:33501016-33501038 GAAGGCTTCCTGGACAGCCTAGG + Intronic
1183400727 22:37602443-37602465 AAAAGCCCCTTGGAGAGGCTGGG - Intergenic
1184262608 22:43328055-43328077 AAATGCCACCTGCCCAGCTTGGG + Intronic
1184485102 22:44773104-44773126 AAAAGCTTCCTGGCCAGGCTTGG - Intronic
1184743697 22:46443958-46443980 CAAAGCCACCGGGAGAGGCTGGG + Intronic
1184791688 22:46703975-46703997 AAAGGCCTCCTGGACACCCATGG + Intronic
1185057686 22:48589461-48589483 AAGAGCCACCTGGAAACCCAGGG + Intronic
952455172 3:33465922-33465944 AAAAGCCACATTGACACCCATGG - Intergenic
953022174 3:39121636-39121658 TAAAGTCACCTGGACAGACAGGG - Intronic
954317085 3:49807025-49807047 AAATGCCAACTGCAGAGCCTGGG + Intronic
955408482 3:58640865-58640887 TCGCGCCACCTGGACAGCCTAGG - Intronic
955571397 3:60310555-60310577 AGAAGCCAACTGGAGAGGCTTGG - Intronic
957067284 3:75535380-75535402 AAAAGCCTCCTGCACAGCATAGG - Intergenic
961285865 3:125802586-125802608 AAAAGCCTCCTGCACAGCATAGG + Intergenic
961900874 3:130210316-130210338 AAAAGCCTCCTGCACAGCATAGG - Intergenic
966417893 3:179708215-179708237 AAAAGCCACTTGGAGATGCTGGG + Intronic
968381445 4:100226-100248 AAAAGCCACATTGACACCCATGG + Intergenic
969011876 4:4071942-4071964 AAAGGCCTCCTGCACAGCATAGG - Intergenic
969106469 4:4810578-4810600 AAAATCCACCTTGCCAGCCAGGG - Intergenic
969742209 4:9037778-9037800 AAAGGCCTCCTGCACAGCATAGG + Intergenic
969801594 4:9570657-9570679 AAAAGCCTCCTGCACAGCATAGG + Intergenic
971103264 4:23493646-23493668 AAGATCCACCTGGCCAGGCTGGG + Intergenic
971210371 4:24610521-24610543 ACAAGCCACCAGGACAGCAGAGG + Intergenic
971388053 4:26159790-26159812 AAGAGCCACTTGGCCAGCTTTGG - Intergenic
972320198 4:37966217-37966239 AGCAAGCACCTGGACAGCCTGGG + Intronic
972644283 4:40953335-40953357 AAAACCCAGATGGACAGCATTGG + Intronic
974685117 4:65217220-65217242 AAAAGTCACATGGACAGCATGGG + Intergenic
974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG + Intronic
975627414 4:76363589-76363611 ACAAGACACGTGGACAGTCTGGG + Intronic
979235239 4:118392583-118392605 TGAAGCCAGCTGGACTGCCTGGG + Intergenic
979826059 4:125233954-125233976 AAAAGCCAACTGAAGAGTCTGGG - Intergenic
985897860 5:2759903-2759925 GGAAGCCACCTGGAGAGCCCCGG - Intergenic
988357471 5:30197746-30197768 TGAAGCCAGCTGGACATCCTGGG + Intergenic
988881599 5:35509256-35509278 AAAAAACACCTGGATAGCCAAGG - Intergenic
989409951 5:41108298-41108320 AAAAGGCACATAGACTGCCTGGG - Intergenic
991177966 5:63712648-63712670 TGAAGCCACCTGGACTTCCTGGG + Intergenic
997597760 5:135118438-135118460 AACTGCCGCCTGGAGAGCCTGGG + Intronic
998394486 5:141809900-141809922 AGCAGCCAGCTGGTCAGCCTGGG + Intergenic
1000657964 5:163904808-163904830 AAAAGCCACAAGGAATGCCTGGG + Intergenic
1001249290 5:170134061-170134083 AAAAGCCACTTGGCCAGACAGGG + Intergenic
1002826467 6:778357-778379 AAAAGCCAGGAGGACAGGCTGGG + Intergenic
1006901018 6:37501350-37501372 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1007475871 6:42119640-42119662 AAAAACAAGCTGGACAGGCTGGG - Intronic
1007585878 6:42989157-42989179 CACAGCCACCTGGAAAGACTGGG - Intronic
1007964290 6:45989202-45989224 AAACACCACCTGGAAAGCATCGG - Intronic
1009187559 6:60591377-60591399 AAAAGGCATCTGCACAGCCAAGG + Intergenic
1019286000 7:223451-223473 CACAGCCACCAGGACAGCCCCGG - Intronic
1019463050 7:1171406-1171428 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1019851302 7:3560866-3560888 AACAGCCATCTGGACACCTTCGG - Intronic
1022394676 7:29976160-29976182 AAAATGCTCCTGGACAGCGTTGG - Intronic
1022812862 7:33886376-33886398 GAAAGCCAGCAGGACAGCTTAGG - Intergenic
1024082217 7:45865013-45865035 AAAAGGGACCTGGAGAGGCTTGG + Intergenic
1027048303 7:75005832-75005854 AAAAACTAGCTGGACAGTCTGGG + Intronic
1028012939 7:85672279-85672301 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1028337944 7:89680530-89680552 ACAAGCCACTTTGACATCCTTGG - Intergenic
1028658010 7:93232649-93232671 AAAACTCACCTGGGCCGCCTGGG + Intronic
1029527554 7:101104300-101104322 AAAGCCCACGTGGCCAGCCTGGG - Intergenic
1031887637 7:127257690-127257712 AAAAGACACCTGTCCAGCCAAGG + Intergenic
1032160487 7:129505771-129505793 AAAAACCTCCTTGACAGGCTGGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032722682 7:134563578-134563600 TGAAGCCACCTGGACTTCCTGGG + Intronic
1034570115 7:151949194-151949216 AAAAGCCATCTGCAGAGCCGGGG - Intergenic
1036247411 8:7130330-7130352 AAAAGCCTCCTGCACAGCATAGG + Intergenic
1036364105 8:8103445-8103467 AAAAGCCTCCTGCACAGCATAGG + Intergenic
1036470371 8:9047464-9047486 AAATGTCACCTGACCAGCCTGGG + Intronic
1036886851 8:12563630-12563652 AAAAGCCTCCTGCACAGCATAGG - Intergenic
1036894449 8:12621749-12621771 AAAAGCCTCCTGCACAGCATAGG - Intergenic
1036920996 8:12855236-12855258 TGAAGCCAGCTGGACATCCTGGG - Intergenic
1037303328 8:17477595-17477617 AGAAGCCAGCTGGACTTCCTGGG + Intergenic
1037589852 8:20303586-20303608 CAAAGACACCTCGACAGCCACGG + Intronic
1038765690 8:30425688-30425710 AAAAGCCACCGGGCCGGGCTCGG - Intronic
1041135186 8:54750504-54750526 AGAAGCCAGCTGGACTTCCTAGG + Intergenic
1042880090 8:73477749-73477771 AAATGCAACCTGGACTGTCTAGG + Intronic
1048439704 8:134450832-134450854 AGAACCCACCTGCATAGCCTGGG + Intergenic
1048685776 8:136903929-136903951 AGAAGCCCGCAGGACAGCCTGGG + Intergenic
1049243124 8:141548743-141548765 GAAGGCCACCTTGCCAGCCTGGG - Intergenic
1049446391 8:142633409-142633431 AGGAGCTACCTGGACAGGCTGGG + Intergenic
1052572241 9:30241669-30241691 AAAAGCCATTTGGGCAGCCTAGG - Intergenic
1055689257 9:78811667-78811689 CAAAGCCACCTGGCCAGCTGGGG - Intergenic
1057027338 9:91744839-91744861 ACTAGCCACCTGAACAGCGTAGG - Intronic
1060120604 9:120986044-120986066 AAAATCCCTCTGGCCAGCCTAGG + Intronic
1060137519 9:121171561-121171583 AAAGCCCAGCTGGCCAGCCTGGG + Intronic
1060347113 9:122827118-122827140 ACAAGCCACCTGCACTGGCTTGG + Intronic
1061430474 9:130527448-130527470 AAATCCCACCCGGACAGCCGCGG + Intergenic
1062139102 9:134945658-134945680 GAAAGCCACCTGGAGAGCGGAGG + Intergenic
1062158102 9:135065341-135065363 GGATGCCACGTGGACAGCCTTGG - Intergenic
1185695234 X:2189076-2189098 TACAGCCACCTGGACAGGGTGGG + Intergenic
1185706437 X:2270736-2270758 TGAAGCCACCTGGACTTCCTGGG + Intronic
1190756170 X:53403942-53403964 AAAAGCTACCTTGACTGCATTGG + Intronic
1192486421 X:71530910-71530932 AGAAGCCAGCTGGACTTCCTGGG - Intronic
1195708257 X:107753719-107753741 AAAAGCCACCTAGAAATACTTGG - Intronic
1197412813 X:126139522-126139544 CAAAGCCAGCTTGGCAGCCTGGG - Intergenic
1198596704 X:138243792-138243814 TTAAGCCACCTGGATAGACTGGG + Intergenic
1200055522 X:153457975-153457997 AAATGCCACCGGGAGTGCCTTGG + Intronic
1200695314 Y:6353494-6353516 TGAAGCCACCTGGACTTCCTGGG - Intergenic
1200945253 Y:8829319-8829341 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1200966378 Y:9043001-9043023 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1201039963 Y:9821216-9821238 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1201312420 Y:12608711-12608733 TAAAGCCAGCTGGACTTCCTAGG - Intergenic
1201348483 Y:13011489-13011511 AAAAGATCCCTGTACAGCCTTGG - Intergenic
1201931228 Y:19351668-19351690 AGAAGCCAGCTGGACTTCCTGGG + Intergenic