ID: 948428354 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:237902408-237902430 |
| Sequence | AAGGACAGGGAGATGGAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2129 | |||
| Summary | {0: 1, 1: 0, 2: 19, 3: 214, 4: 1895} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948428341_948428354 | 17 | Left | 948428341 | 2:237902368-237902390 | CCAGGAGGAGAGAGGGATCAGGA | 0: 1 1: 0 2: 5 3: 58 4: 435 |
||
| Right | 948428354 | 2:237902408-237902430 | AAGGACAGGGAGATGGAGGAGGG | 0: 1 1: 0 2: 19 3: 214 4: 1895 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948428354 | Original CRISPR | AAGGACAGGGAGATGGAGGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||