ID: 948428354

View in Genome Browser
Species Human (GRCh38)
Location 2:237902408-237902430
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2129
Summary {0: 1, 1: 0, 2: 19, 3: 214, 4: 1895}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948428341_948428354 17 Left 948428341 2:237902368-237902390 CCAGGAGGAGAGAGGGATCAGGA 0: 1
1: 0
2: 5
3: 58
4: 435
Right 948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG 0: 1
1: 0
2: 19
3: 214
4: 1895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr