ID: 948429303

View in Genome Browser
Species Human (GRCh38)
Location 2:237909071-237909093
Sequence AATGAGCCCTTGCCCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948429303_948429308 -10 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429308 2:237909084-237909106 AGGGCTCATTCAAGGCTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 136
948429303_948429310 10 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG 0: 1
1: 0
2: 1
3: 5
4: 101
948429303_948429309 -3 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429309 2:237909091-237909113 ATTCAAGGCTCTCTGGCTTACGG 0: 1
1: 0
2: 0
3: 22
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948429303 Original CRISPR AATGAGCCCTTGCCCCATGG GGG (reversed) Intronic