ID: 948429308

View in Genome Browser
Species Human (GRCh38)
Location 2:237909084-237909106
Sequence AGGGCTCATTCAAGGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948429297_948429308 9 Left 948429297 2:237909052-237909074 CCTAGAGGCACTCAGGCTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 279
Right 948429308 2:237909084-237909106 AGGGCTCATTCAAGGCTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 136
948429295_948429308 14 Left 948429295 2:237909047-237909069 CCTGCCCTAGAGGCACTCAGGCT 0: 1
1: 0
2: 1
3: 20
4: 231
Right 948429308 2:237909084-237909106 AGGGCTCATTCAAGGCTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 136
948429303_948429308 -10 Left 948429303 2:237909071-237909093 CCCCCATGGGGCAAGGGCTCATT 0: 1
1: 0
2: 1
3: 13
4: 115
Right 948429308 2:237909084-237909106 AGGGCTCATTCAAGGCTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 136
948429296_948429308 10 Left 948429296 2:237909051-237909073 CCCTAGAGGCACTCAGGCTGCCC 0: 1
1: 0
2: 0
3: 20
4: 150
Right 948429308 2:237909084-237909106 AGGGCTCATTCAAGGCTCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948429308 Original CRISPR AGGGCTCATTCAAGGCTCTC TGG Intronic